Site Map
Latest Release
Bowtie2 v2.5.3 | 01/16/24 |
Please cite: Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012, 9:357-359. |
Links
Indexes
All indexes are .bt2 format and are compatible with both Bowtie 2 and with Bowtie as of v1.2.3
Index storage is thanks to AWS Public Datasets program. See the Index zone page for details on the best ways to obtain this data, including from the AWS cloud.
Publications
- Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012, 9:357-359.
- Langmead B, Wilks C, Antonescu V, Charles R. Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics Vol 35, Iss 3, 2019, pp 421–432.
Contributors
- Ben Langmead
- Daehwan Kim
- Rone Charles
- Nae-Chyun Chen
- Chris Wilks
- Valentin Antonescu
Introduction
Bowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index (based on the Burrows-Wheeler Transform or BWT) to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple processors can be used simultaneously to achieve greater alignment speed.
Bowtie 2 outputs alignments in SAM format, enabling interoperation with a large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie 2 is distributed under the GPLv3 license, and it runs on the command line under Windows, Mac OS X and Linux and BSD.
Bowtie 2 is often the first step in pipelines for comparative genomics, including for variation calling, ChIP-seq, RNA-seq, BS-seq. Bowtie 2 and Bowtie (also called "Bowtie 1" here) are also tightly integrated into many other tools, some of which are listed here.
If you use Bowtie 2 for your published research, please cite our work. Papers describing Bowtie 2 are:
Langmead B, Wilks C, Antonescu V, Charles R. Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics. 2018 Jul 18. doi: 10.1093/bioinformatics/bty648.
Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012 Mar 4;9(4):357-9. doi: 10.1038/nmeth.1923.
How is Bowtie 2 different from Bowtie 1?
Bowtie 1 was released in 2009 and was geared toward aligning the relatively short sequencing reads (up to 25-50 nucleotides) prevalent at the time. Since then, technology has improved both sequencing throughput (more nucleotides produced per sequencer per day) and read length (more nucleotides per read).
The chief differences between Bowtie 1 and Bowtie 2 are:
For reads longer than about 50 bp Bowtie 2 is generally faster, more sensitive, and uses less memory than Bowtie 1. For relatively short reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or more sensitive.
Bowtie 2 supports gapped alignment with affine gap penalties. Number of gaps and gap lengths are not restricted, except by way of the configurable scoring scheme. Bowtie 1 finds just ungapped alignments.
Bowtie 2 supports local alignment, which doesn't require reads to align end-to-end. Local alignments might be "trimmed" ("soft clipped") at one or both extremes in a way that optimizes alignment score. Bowtie 2 also supports end-to-end alignment which, like Bowtie 1, requires that the read align entirely.
There is no upper limit on read length in Bowtie 2. Bowtie 1 had an upper limit of around 1000 bp.
Bowtie 2 allows alignments to overlap ambiguous characters (e.g.
N
s) in the reference. Bowtie 1 does not.Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", and its distinction between "Maq-like" and "end-to-end" modes. In Bowtie 2 all alignments lie along a continuous spectrum of alignment scores where the scoring scheme, similar to Needleman-Wunsch and Smith-Waterman.
Bowtie 2's paired-end alignment is more flexible. E.g. for pairs that do not align in a paired fashion, Bowtie 2 attempts to find unpaired alignments for each mate.
Bowtie 2 reports a spectrum of mapping qualities, in contrast for Bowtie 1 which reports either 0 or high.
Bowtie 2 does not align colorspace reads.
Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's command-line arguments and genome index format are both different from Bowtie 1's.
What isn't Bowtie 2?
Bowtie 2 is geared toward aligning relatively short sequencing reads to long genomes. That said, it handles arbitrarily small reference sequences (e.g. amplicons) and very long reads (i.e. upwards of 10s or 100s of kilobases), though it is slower in those settings. It is optimized for the read lengths and error modes yielded by typical Illumina sequencers.
Bowtie 2 does not support alignment of colorspace reads. (Bowtie 1 does.)
Obtaining Bowtie 2
Bowtie 2 is available from various package managers, notably Bioconda. With Bioconda
installed, you should be able to install Bowtie 2 with
conda install bowtie2
.
You can also download Bowtie 2 sources and binaries from the Download
section of the Sourceforge site. Binaries are available for the
x86_64
architecture running Linux, Mac OS X, and Windows.
FreeBSD users can obtain the latest version of Bowtie 2 from ports using
pkg install bowtie2
. If you plan to compile Bowtie 2
yourself, make sure to get the source package, i.e., the filename that
ends in "-source.zip".
Building from source
Building from source
Building Bowtie 2 from source requires a GNU-like environment with Clang/GCC, GNU Make and other basics. It should be possible to build Bowtie 2 on most vanilla *NIX installations or on a Mac installation with Xcode installed. Bowtie 2 can also be built on Windows using a 64-bit MinGW distribution and MSYS. In order to simplify the MinGW setup it might be worth investigating popular MinGW personal builds since these are coming already prepared with most of the toolchains needed.
First, download the source package from the sourceforge
site. Make sure you're getting the source package; the file
downloaded should end in -source.zip
. Unzip the file,
change to the unzipped directory, and build the Bowtie 2 tools by
running GNU make
(usually with the command
make
, but sometimes with gmake
) with no
arguments. If building with MinGW, run make
from the MSYS
environment.
The Bowtie 2 Makefile also includes recipes for basic automatic
dependency management. Running
make static-libs && make STATIC_BUILD=1
will issue
a series of commands that will: 1. download zstd and zlib 2. compile
them as static libraries 3. link the resulting libraries to the compiled
Bowtie 2 binaries
Building with SRA support
As of version 2.3.5 bowtie2 now supports aligning SRA reads.
Prepackaged builds will include a package that supports SRA. If you're
building bowtie2 from source please make sure that the Java runtime is
available on your system. You can then proceed with the build by running
make sra-deps && make USE_SRA=1
.
Building with libsais support
As of version 2.5.3 bowtie2
supports building indexes
using the SAIS algorithm provided by libsais. SAIS is a
state-of-the-art suffix array construction algorithm that will
bring-forth a significant speed-up to the overall index building
process. There is, however, the downside of a significant increase in
memory usage compared to the persistent blockwise algorithm that
bowtie2-build
uses by default. When using SAIS small
indexes can be built for inputs up to 2GB. The
bowtie2-build
wrapper will help determine the appropriate
index type for uncompressed and gzipped inputs.
To build bowtie2-build
with libsais first make
sure that the libsais submodule is available. This can be done in one of
the following ways: * first time cloning bowtie2 --
git clone --recursive https://github.com/BenLangmead/bowtie2.git
* existing checkout of bowtie2 --
git submodule init && git submodule update
Issue the following command line to build libsais: * with OpenMP
support -- [g]make libsais USE_SAIS_OPENMP=1
* without
OpenMP support -- [g]make libsais USE_SAIS=1
The choice of using OpenMP will determine whether or not the
algorithm runs multithreaded. The [-p/--threads
] argument
to bowtie2-build
will be ignored when libsais is compiled
without OpenMP support.
Finally, building the build executable: * with OpenMP support --
[g]make bowtie2-build-s USE_SAIS_OPENMP=1
* without OpenMP
support -- [g]make bowtie2-build-s USE_SAIS=1
Building with CMake
To build Bowtie2 with SRA and libsais support issue the following
command: *
cmake . -D USE_SRA=1 -D USE_SAIS=1 && cmake --build .
CMake will take care of building and linking against the specified dependencies.
Adding to PATH
By adding your new Bowtie 2 directory to your PATH environment
variable, you ensure that whenever you run bowtie2
,
bowtie2-build
or bowtie2-inspect
from the
command line, you will get the version you just installed without having
to specify the entire path. This is recommended for most users. To do
this, follow your operating system's instructions for adding the
directory to your PATH.
If you would like to install Bowtie 2 by copying the Bowtie 2
executable files to an existing directory in your PATH, make sure
that you copy all the executables, including bowtie2
,
bowtie2-align-s
, bowtie2-align-l
,
bowtie2-build
, bowtie2-build-s
,
bowtie2-build-l
, bowtie2-inspect
,
bowtie2-inspect-s
and bowtie2-inspect-l
.
The bowtie2
aligner
bowtie2
takes a Bowtie 2 index and a set of sequencing
read files and outputs a set of alignments in SAM format.
"Alignment" is the process by which we discover how and where the read sequences are similar to the reference sequence. An "alignment" is a result from this process, specifically: an alignment is a way of "lining up" some or all of the characters in the read with some characters from the reference in a way that reveals how they're similar. For example:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
Where dash symbols represent gaps and vertical bars show where aligned characters match.
We use alignment to make an educated guess as to where a read
originated with respect to the reference genome. It's not always
possible to determine this with certainty. For instance, if the
reference genome contains several long stretches of As
(AAAAAAAAA
etc.) and the read sequence is a short stretch
of As (AAAAAAA
), we cannot know for certain exactly where
in the sea of A
s the read originated.
End-to-end alignment versus local alignment
By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment.
When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score.
End-to-end alignment example
The following is an "end-to-end" alignment because it involves all the characters in the read. Such an alignment can be produced by Bowtie 2 in either end-to-end mode or in local mode.
Read: GACTGGGCGATCTCGACTTCG
Reference: GACTGCGATCTCGACATCG
Alignment:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
Local alignment example
The following is a "local" alignment because some of the characters at the ends of the read do not participate. In this case, 4 characters are omitted (or "soft trimmed" or "soft clipped") from the beginning and 3 characters are omitted from the end. This sort of alignment can be produced by Bowtie 2 only in local mode.
Read: ACGGTTGCGTTAATCCGCCACG
Reference: TAACTTGCGTTAAATCCGCCTGG
Alignment:
Read: ACGGTTGCGTTAA-TCCGCCACG
||||||||| ||||||
Reference: TAACTTGCGTTAAATCCGCCTGG
Scores: higher = more similar
An alignment score quantifies how similar the read sequence is to the reference sequence aligned to. The higher the score, the more similar they are. A score is calculated by subtracting penalties for each difference (mismatch, gap, etc.) and, in local alignment mode, adding bonuses for each match.
The scores can be configured with the --ma
(match bonus), --mp
(mismatch penalty), --np
(penalty for having an
N in either the read or the reference), --rdg
(affine read gap
penalty) and --rfg
(affine reference gap penalty) options.
End-to-end alignment score example
A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). Thus, in end-to-end alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score is -(6 + 11) = -17.
The best possible alignment score in end-to-end mode is 0, which happens when there are no differences between the read and the reference.
Local alignment score example
A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). A base that matches receives a bonus of +2 be default. Thus, in local alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.
The best possible score in local mode equals the match bonus times the length of the read. This happens when there are no differences between the read and the reference.
Valid alignments meet or exceed the minimum score threshold
For an alignment to be considered "valid" (i.e. "good enough") by
Bowtie 2, it must have an alignment score no less than the minimum score
threshold. The threshold is configurable and is expressed as a function
of the read length. In end-to-end alignment mode, the default minimum
score threshold is -0.6 + -0.6 * L
, where L
is
the read length. In local alignment mode, the default minimum score
threshold is 20 + 8.0 * ln(L)
, where L is the read length.
This can be configured with the --score-min
option.
For details on how to set options like --score-min
that
correspond to functions, see the section on setting function options.
Mapping quality: higher = more unique
The aligner cannot always assign a read to its point of origin with high confidence. For instance, a read that originated inside a repeat element might align equally well to many occurrences of the element throughout the genome, leaving the aligner with no basis for preferring one over the others.
Aligners characterize their degree of confidence in the point of
origin by reporting a mapping quality: a non-negative integer Q = -10
log10 p, where p is an estimate of the probability that the alignment
does not correspond to the read's true point of origin. Mapping quality
is sometimes abbreviated MAPQ, and is recorded in the SAM
MAPQ
field.
Mapping quality is related to "uniqueness." We say an alignment is unique if it has a much higher alignment score than all the other possible alignments. The bigger the gap between the best alignment's score and the second-best alignment's score, the more unique the best alignment, and the higher its mapping quality should be.
Accurate mapping qualities are useful for downstream tools like variant callers. For instance, a variant caller might choose to ignore evidence from alignments with mapping quality less than, say, 10. A mapping quality of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere.
Aligning pairs
A "paired-end" or "mate-pair" read consists of pair of mates, called mate 1 and mate 2. Pairs come with a prior expectation about (a) the relative orientation of the mates, and (b) the distance separating them on the original DNA molecule. Exactly what expectations hold for a given dataset depends on the lab procedures used to generate the data. For example, a common lab procedure for producing pairs is Illumina's Paired-end Sequencing Assay, which yields pairs with a relative orientation of FR ("forward, reverse") meaning that if mate 1 came from the Watson strand, mate 2 very likely came from the Crick strand and vice versa. Also, this protocol yields pairs where the expected genomic distance from end to end is about 200-500 base pairs.
For simplicity, this manual uses the term "paired-end" to refer to any pair of reads with some expected relative orientation and distance. Depending on the protocol, these might actually be referred to as "paired-end" or "mate-paired." Also, we always refer to the individual sequences making up the pair as "mates."
Paired inputs
Pairs are often stored in a pair of files, one file containing the
mate 1s and the other containing the mates 2s. The first mate in the
file for mate 1 forms a pair with the first mate in the file for mate 2,
the second with the second, and so on. When aligning pairs with Bowtie
2, specify the file with the mate 1s mates using the -1
argument and the file with
the mate 2s using the -2
argument. This causes Bowtie 2 to take the paired nature of the reads
into account when aligning them.
Paired SAM output
When Bowtie 2 prints a SAM alignment for a pair, it prints two
records (i.e. two lines of output), one for each mate. The first record
describes the alignment for mate 1 and the second record describes the
alignment for mate 2. In both records, some of the fields of the SAM
record describe various properties of the alignment; for instance, the
7th and 8th fields (RNEXT
and PNEXT
respectively) indicate the reference name and position where the other
mate aligned, and the 9th field indicates the inferred length of the DNA
fragment from which the two mates were sequenced. See the SAM specification
for more details regarding these fields.
Concordant pairs match pair expectations, discordant pairs don't
A pair that aligns with the expected relative mate orientation and with the expected range of distances between mates is said to align "concordantly". If both mates have unique alignments, but the alignments do not match paired-end expectations (i.e. the mates aren't in the expected relative orientation, or aren't within the expected distance range, or both), the pair is said to align "discordantly". Discordant alignments may be of particular interest, for instance, when seeking structural variants.
The expected relative orientation of the mates is set using the --ff
, --fr
, or --rf
options. The expected
range of inter-mates distances (as measured from the furthest extremes
of the mates; also called "outer distance") is set with the -I
and -X
options. Note that setting
-I
and -X
far apart makes Bowtie 2
slower. See documentation for -I
and -X
.
To declare that a pair aligns discordantly, Bowtie 2 requires that both mates align uniquely. This is a conservative threshold, but this is often desirable when seeking structural variants.
By default, Bowtie 2 searches for both concordant and discordant
alignments, though searching for discordant alignments can be disabled
with the --no-discordant
option.
Mixed mode: paired where possible, unpaired otherwise
If Bowtie 2 cannot find a paired-end alignment for a pair, by default
it will go on to look for unpaired alignments for the constituent mates.
This is called "mixed mode." To disable mixed mode, set the --no-mixed
option.
Bowtie 2 runs a little faster in --no-mixed
mode, but
will only consider alignment status of pairs per se, not individual
mates.
Some SAM FLAGS describe paired-end properties
The SAM FLAGS
field, the second field in a SAM record,
has multiple bits that describe the paired-end nature of the read and
alignment. The first (least significant) bit (1 in decimal, 0x1 in
hexadecimal) is set if the read is part of a pair. The second bit (2 in
decimal, 0x2 in hexadecimal) is set if the read is part of a pair that
aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in
hexadecimal) is set if the read is part of a pair and the other mate in
the pair had at least one valid alignment. The sixth bit (32 in decimal,
0x20 in hexadecimal) is set if the read is part of a pair and the other
mate in the pair aligned to the Crick strand (or, equivalently, if the
reverse complement of the other mate aligned to the Watson strand). The
seventh bit (64 in decimal, 0x40 in hexadecimal) is set if the read is
mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexadecimal)
is set if the read is mate 2 in a pair. See the SAM specification
for a more detailed description of the FLAGS
field.
Some SAM optional fields describe more paired-end properties
The last several fields of each SAM record usually contain SAM
optional fields, which are simply tab-separated strings conveying
additional information about the reads and alignments. A SAM optional
field is formatted like this: "XP:i:1" where "XP" is the
TAG
, "i" is the TYPE
("integer" in this case),
and "1" is the VALUE
. See the SAM specification
for details regarding SAM optional fields.
Mates can overlap, contain, or dovetail each other
The fragment and read lengths might be such that alignments for the two mates from a pair overlap each other. Consider this example:
(For these examples, assume we expect mate 1 to align to the left of mate 2.)
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTT
Mate 2: TGTTTGGGGTGACACATTACGCGTCTTTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
It's also possible, though unusual, for one mate alignment to contain the other, as in these examples:
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TGTTTGGGGTGACACATTACGC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
Mate 1: CAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: CTACGATATTGTTTGGGGTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
And it's also possible, though unusual, for the mates to "dovetail", with the mates seemingly extending "past" each other as in this example:
Mate 1: GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
In some situations, it's desirable for the aligner to consider all these cases as "concordant" as long as other paired-end constraints are not violated. Bowtie 2's default behavior is to consider overlapping and containing as being consistent with concordant alignment. By default, dovetailing is considered inconsistent with concordant alignment.
These defaults can be overridden. Setting --no-overlap
causes
Bowtie 2 to consider overlapping mates as non-concordant. Setting --no-contain
causes
Bowtie 2 to consider cases where one mate alignment contains the other
as non-concordant. Setting --dovetail
causes
Bowtie 2 to consider cases where the mate alignments dovetail as
concordant.
Reporting
The reporting mode governs how many alignments Bowtie 2 looks for,
and how to report them. Bowtie 2 has three distinct reporting modes. The
default reporting mode is similar to the default reporting mode of many
other read alignment tools, including BWA. It is also similar to
Bowtie 1's -M
alignment mode.
In general, when we say that a read has an alignment, we mean that it has a valid alignment. When we say that a read has multiple alignments, we mean that it has multiple alignments that are valid and distinct from one another.
Distinct alignments map a read to different places
Two alignments for the same individual read are "distinct" if they map the same read to different places. Specifically, we say that two alignments are distinct if there are no alignment positions where a particular read offset is aligned opposite a particular reference offset in both alignments with the same orientation. E.g. if the first alignment is in the forward orientation and aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, and the second alignment is also in the forward orientation and also aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, they are not distinct alignments.
Two alignments for the same pair are distinct if either the mate 1s in the two paired-end alignments are distinct or the mate 2s in the two alignments are distinct or both.
Default mode: search for multiple alignments, report the best one
By default, Bowtie 2 searches for distinct, valid alignments for each
read. When it finds a valid alignment, it generally will continue to
look for alignments that are nearly as good or better. It will
eventually stop looking, either because it exceeded a limit placed on
search effort (see -D
and
-R
) or because it already
knows all it needs to know to report an alignment. Information from the
best alignments are used to estimate mapping quality (the
MAPQ
SAM field) and to
set SAM optional fields, such as AS:i
and XS:i
. Bowtie 2 does
not guarantee that the alignment reported is the best possible in terms
of alignment score.
See also: -D
, which
puts an upper limit on the number of dynamic programming problems (i.e.
seed extensions) that can "fail" in a row before Bowtie 2 stops
searching. Increasing -D
makes Bowtie 2 slower, but increases the likelihood that it will report
the correct alignment for a read that aligns many places.
See also: -R
, which
sets the maximum number of times Bowtie 2 will "re-seed" when attempting
to align a read with repetitive seeds. Increasing -R
makes Bowtie 2 slower, but
increases the likelihood that it will report the correct alignment for a
read that aligns many places.
-k mode: search for one or more alignments, report each
In -k
mode, Bowtie 2
searches for up to N distinct, valid alignments for each read, where N
equals the integer specified with the -k
parameter. That
is, if -k 2
is specified, Bowtie 2 will search for at most
2 distinct alignments. It reports all alignments found, in descending
order by alignment score. The alignment score for a paired-end alignment
equals the sum of the alignment scores of the individual mates. Each
reported read or pair alignment beyond the first has the SAM 'secondary'
bit (which equals 256) set in its FLAGS field. Supplementary alignments
will also be assigned a MAPQ of 255. See the SAM specification
for details.
Bowtie 2 does not "find" alignments in any specific order, so for reads that have more than N distinct, valid alignments, Bowtie 2 does not guarantee that the N alignments reported are the best possible in terms of alignment score. Still, this mode can be effective and fast in situations where the user cares more about whether a read aligns (or aligns a certain number of times) than where exactly it originated.
-a mode: search for and report all alignments
-a
mode is similar to
-k
mode except that there
is no upper limit on the number of alignments Bowtie 2 should report.
Alignments are reported in descending order by alignment score. The
alignment score for a paired-end alignment equals the sum of the
alignment scores of the individual mates. Each reported read or pair
alignment beyond the first has the SAM 'secondary' bit (which equals
256) set in its FLAGS field. Supplementary alignments will be assigned a
MAPQ of 255. See the SAM specification
for details.
Some tools are designed with this reporting mode in mind. Bowtie 2 is not! For very large genomes, this mode is very slow.
Randomness in Bowtie 2
Bowtie 2's search for alignments for a given read is "randomized." That is, when Bowtie 2 encounters a set of equally-good choices, it uses a pseudo-random number to choose. For example, if Bowtie 2 discovers a set of 3 equally-good alignments and wants to decide which to report, it picks a pseudo-random integer 0, 1 or 2 and reports the corresponding alignment. Arbitrary choices can crop up at various points during alignment.
The pseudo-random number generator is re-initialized for every read,
and the seed used to initialize it is a function of the read name,
nucleotide string, quality string, and the value specified with --seed
. If you run the
same version of Bowtie 2 on two reads with identical names, nucleotide
strings, and quality strings, and if --seed
is set the same for
both runs, Bowtie 2 will produce the same output; i.e., it will align
the read to the same place, even if there are multiple equally good
alignments. This is intuitive and desirable in most cases. Most users
expect Bowtie to produce the same output when run twice on the same
input.
However, when the user specifies the --non-deterministic
option, Bowtie 2 will use the current time to re-initialize the
pseudo-random number generator. When this is specified, Bowtie 2 might
report different alignments for identical reads. This is
counter-intuitive for some users, but might be more appropriate in
situations where the input consists of many identical reads.
Multiseed heuristic
To rapidly narrow the number of possible alignments that must be considered, Bowtie 2 begins by extracting substrings ("seeds") from the read and its reverse complement and aligning them in an ungapped fashion with the help of the FM Index. This is "multiseed alignment" and it is similar to what Bowtie 1 does, except Bowtie 1 attempts to align the entire read this way.
This initial step makes Bowtie 2 much faster than it would be without such a filter, but at the expense of missing some valid alignments. For instance, it is possible for a read to have a valid overall alignment but to have no valid seed alignments because each potential seed alignment is interrupted by too many mismatches or gaps.
The trade-off between speed and sensitivity/accuracy can be adjusted
by setting the seed length (-L
), the interval between
extracted seeds (-i
), and
the number of mismatches permitted per seed (-N
). For more sensitive
alignment, set these parameters to (a) make the seeds closer together,
(b) make the seeds shorter, and/or (c) allow more mismatches. You can
adjust these options one-by-one, though Bowtie 2 comes with some useful
combinations of options prepackaged as "preset options."
-D
and -R
are also options that
adjust the trade-off between speed and sensitivity/accuracy.
FM Index memory footprint
Bowtie 2 uses the FM Index to find ungapped alignments for seeds. This step accounts for the bulk of Bowtie 2's memory footprint, as the FM Index itself is typically the largest data structure used. For instance, the memory footprint of the FM Index for the human genome is about 3.2 gigabytes of RAM.
Ambiguous characters
Non-whitespace characters besides A, C, G or T are considered "ambiguous." N is a common ambiguous character that appears in reference sequences. Bowtie 2 considers all ambiguous characters in the reference (including IUPAC nucleotide codes) to be Ns.
Bowtie 2 allows alignments to overlap ambiguous characters in the
reference. An alignment position that contains an ambiguous character in
the read, reference, or both, is penalized according to --np
. --n-ceil
sets an upper
limit on the number of positions that may contain ambiguous reference
characters in a valid alignment. The optional field XN:i
reports the
number of ambiguous reference characters overlapped by an alignment.
Note that the multiseed heuristic cannot find seed alignments that overlap ambiguous reference characters. For an alignment overlapping an ambiguous reference character to be found, it must have one or more seed alignments that do not overlap ambiguous reference characters.
Presets: setting many settings at once
Bowtie 2 comes with some useful combinations of parameters packaged
into shorter "preset" parameters. For example, running Bowtie 2 with the
--very-sensitive
option is the same as running with options:
-D 20 -R 3 -N 0 -L 20 -i S,1,0.50
. The preset options that
come with Bowtie 2 are designed to cover a wide area of the
speed/sensitivity/accuracy trade-off space, with the presets ending in
fast
generally being faster but less sensitive and less
accurate, and the presets ending in sensitive
generally
being slower but more sensitive and more accurate. See the documentation for the preset
options for details.
As of Bowtie2 v2.4.0, individual preset values can be overridden by
providing the specific options e.g. the configured seed length of 20 in
the [--very-senitive
] preset above can be changed to 25 by
also specifying the -L 25
parameter anywhere on the command
line.
Filtering
Some reads are skipped or "filtered out" by Bowtie 2. For example,
reads may be filtered out because they are extremely short or have a
high proportion of ambiguous nucleotides. Bowtie 2 will still print a
SAM record for such a read, but no alignment will be reported and the
YF:i
SAM optional field will be set to indicate the reason
the read was filtered.
YF:Z:LN
: the read was filtered because it had length less than or equal to the number of seed mismatches set with the-N
option.YF:Z:NS
: the read was filtered because it contains a number of ambiguous characters (usuallyN
or.
) greater than the ceiling specified with--n-ceil
.YF:Z:SC
: the read was filtered because the read length and the match bonus (set with--ma
) are such that the read can't possibly earn an alignment score greater than or equal to the threshold set with--score-min
YF:Z:QC
: the read was filtered because it was marked as failing quality control and the user specified the--qc-filter
option. This only happens when the input is in Illumina's QSEQ format (i.e. when--qseq
is specified) and the last (11th) field of the read's QSEQ record contains1
.
If a read could be filtered for more than one reason, the value
YF:Z
flag will reflect only one of those reasons.
Alignment summary
When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:
20000 reads; of these:
20000 (100.00%) were unpaired; of these:
1247 (6.24%) aligned 0 times
18739 (93.69%) aligned exactly 1 time
14 (0.07%) aligned >1 times
93.77% overall alignment rate
For datasets consisting of pairs, the summary might look like this:
10000 reads; of these:
10000 (100.00%) were paired; of these:
650 (6.50%) aligned concordantly 0 times
8823 (88.23%) aligned concordantly exactly 1 time
527 (5.27%) aligned concordantly >1 times
----
650 pairs aligned concordantly 0 times; of these:
34 (5.23%) aligned discordantly 1 time
----
616 pairs aligned 0 times concordantly or discordantly; of these:
1232 mates make up the pairs; of these:
660 (53.57%) aligned 0 times
571 (46.35%) aligned exactly 1 time
1 (0.08%) aligned >1 times
96.70% overall alignment rate
The indentation indicates how subtotals relate to totals.
Wrapper scripts
The bowtie2
, bowtie2-build
and
bowtie2-inspect
executables are actually wrapper scripts
that call binary programs as appropriate. The wrappers shield users from
having to distinguish between "small" and "large" index formats,
discussed briefly in the following section. Also, the
bowtie2
wrapper provides some key functionality, like the
ability to handle compressed inputs, and the functionality for --un
, --al
and related
options.
It is recommended that you always run the bowtie2 wrappers and not run the binaries directly.
Small and large indexes
bowtie2-build
can index reference genomes of any size.
For genomes less than about 4 billion nucleotides in length,
bowtie2-build
builds a "small" index using 32-bit numbers
in various parts of the index. When the genome is longer,
bowtie2-build
builds a "large" index using 64-bit numbers.
Small indexes are stored in files with the .bt2
extension,
and large indexes are stored in files with the .bt2l
extension. The user need not worry about whether a particular index is
small or large; the wrapper scripts will automatically build and use the
appropriate index.
Performance tuning
If your computer has multiple processors/cores, use
-p
The
-p
option causes Bowtie 2 to launch a specified number of parallel search threads. Each thread runs on a different processor/core and all threads find alignments in parallel, increasing alignment throughput by approximately a multiple of the number of threads (though in practice, speedup is somewhat worse than linear).If reporting many alignments per read, try reducing
bowtie2-build --offrate
If you are using
-k
or-a
options and Bowtie 2 is reporting many alignments per read, using an index with a denser SA sample can speed things up considerably. To do this, specify a smaller-than-default-o
/--offrate
value when runningbowtie2-build
. A denser SA sample yields a larger index, but is also particularly effective at speeding up alignment when many alignments are reported per read.If
bowtie2
"thrashes", try increasingbowtie2-build --offrate
If
bowtie2
runs very slowly on a relatively low-memory computer, try setting-o
/--offrate
to a larger value when building the index. This decreases the memory footprint of the index.
Command Line
Setting function options
Some Bowtie 2 options specify a function rather than an individual
number or setting. In these cases the user specifies three parameters:
(a) a function type F
, (b) a constant term B
,
and (c) a coefficient A
. The available function types are
constant (C
), linear (L
), square-root
(S
), and natural log (G
). The parameters are
specified as F,B,A
- that is, the function type, the
constant term, and the coefficient are separated by commas with no
whitespace. The constant term and coefficient may be negative and/or
floating-point numbers.
For example, if the function specification is
L,-0.4,-0.6
, then the function defined is:
f(x) = -0.4 + -0.6 * x
If the function specification is G,1,5.4
, then the
function defined is:
f(x) = 1.0 + 5.4 * ln(x)
See the documentation for the option in question to learn what the
parameter x
is for. For example, in the case if the --score-min
option,
the function f(x)
sets the minimum alignment score
necessary for an alignment to be considered valid, and x
is
the read length.
Usage
bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | --sra-acc <acc> | b <bam>} -S [<sam>]
Main arguments
|
The basename of the index for the reference genome. The basename is
the name of any of the index files up to but not including the final
|
|
Comma-separated list of files containing mate 1s (filename usually
includes |
|
Comma-separated list of files containing mate 2s (filename usually
includes |
|
Comma-separated list of files containing unpaired reads to be
aligned, e.g. |
|
Reads interleaved FASTQ files where the first two records (8 lines) represent a mate pair. |
|
Reads are SRA accessions. If the accession provided cannot be found
in local storage it will be fetched from the NCBI database. If you find
that SRA alignments are long running please rerun your command with the
NB: this option is only available if bowtie 2 is compiled with the necessary SRA libraries. See Obtaining Bowtie 2 for details. |
|
Reads are unaligned BAM records sorted by read name. The |
|
File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console). |
Options
Input options
|
Reads (specified with |
|
Each read or pair is on a single line. An unpaired read line is
|
|
Similar to |
|
Reads (specified with |
|
Reads (specified with |
|
Reads (specified with |
|
Reads are substrings (k-mers) extracted from a FASTA file. Specifically,
for every reference sequence in the FASTA file, Bowtie 2 aligns the
k-mers at offsets 1, 1+i, 1+2i, ... until reaching the end of the
reference. Each k-mer is aligned as a separate read. Quality values are
set to all Is (40 on Phred scale). Each k-mer (read) is given a name
like <sequence>_<offset> , where
<sequence> is the name of the FASTA sequence it was
drawn from and <offset> is its 0-based offset of
origin with respect to the sequence. Only single k-mers, i.e. unpaired
reads, can be aligned in this way.
|
|
The read sequences are given on command line. I.e.
|
|
Skip (i.e. do not align) the first |
|
Align the first |
|
Trim |
|
Trim |
|
Trim reads exceeding |
|
Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines. |
|
Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding. |
|
Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3). Default: off. |
|
Quality values are represented in the read input file as
space-separated ASCII integers, e.g., |
Preset options in
--end-to-end
mode
|
Same as: |
|
Same as: |
|
Same as: |
|
Same as: |
Preset options in
--local
mode
|
Same as: |
|
Same as: |
|
Same as: |
|
Same as: |
Alignment options
|
Sets the number of mismatches to allowed in a seed alignment during multiseed alignment. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0. |
|
Sets the length of the seed substrings to align during multiseed alignment. Smaller values make
alignment slower but more sensitive. Default: the |
|
Sets a function governing the interval between seed substrings to use during multiseed alignment. For instance, if the read has 30 characters, and seed length is 10, and the seed interval is 6, the seeds extracted will be:
Since it's best to use longer intervals for longer reads, this
parameter sets the interval as a function of the read length, rather
than a single one-size-fits-all number. For instance, specifying
|
|
Sets a function governing the maximum number of ambiguous characters
(usually |
|
"Pads" dynamic programming problems by |
|
Disallow gaps within |
|
When calculating a mismatch penalty, always consider the quality
value at the mismatched position to be the highest possible, regardless
of the actual value. I.e. input is treated as though all quality values
are high. This is also the default behavior when the input doesn't
specify quality values (e.g. in |
|
If |
|
By default, Bowtie 2 will attempt to find either an exact or a
1-mismatch end-to-end alignment for the read before trying the
multiseed heuristic. Such alignments
can be found very quickly, and many short read alignments have exact or
near-exact end-to-end alignments. However, this can lead to unexpected
alignments when the user also sets options governing the multiseed heuristic, like |
|
In this mode, Bowtie 2 requires that the entire read align from one
end to the other, without any trimming (or "soft clipping") of
characters from either end. The match bonus |
|
In this mode, Bowtie 2 does not require that the entire read align
from one end to the other. Rather, some characters may be omitted ("soft
clipped") from the ends in order to achieve the greatest possible
alignment score. The match bonus |
Scoring options
|
Sets the match bonus. In |
|
Sets the maximum ( |
|
Sets penalty for positions where the read, reference, or both,
contain an ambiguous character such as |
|
Sets the read gap open ( |
|
Sets the reference gap open ( |
|
Sets a function governing the minimum alignment score needed for an
alignment to be considered "valid" (i.e. good enough to report). This is
a function of read length. For instance, specifying
|
Reporting options
|
By default, When Note: Bowtie 2 is not designed with large values for |
|
Like Note: Bowtie 2 is not designed with |
Effort options
|
Up to |
|
|
Paired-end options
|
The minimum fragment length for valid paired-end alignments. E.g. if
The larger the difference between Default: 0 (essentially imposing no minimum) |
|
The maximum fragment length for valid paired-end alignments. E.g. if
The larger the difference between Default: 500. |
|
The upstream/downstream mate orientations for a valid paired-end
alignment against the forward reference strand. E.g., if
|
|
By default, when |
|
By default, |
|
If the mates "dovetail", that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates cannot dovetail in a concordant alignment. |
|
If one mate alignment contains the other, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: a mate can contain the other in a concordant alignment. |
|
If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates can overlap in a concordant alignment. |
BAM options
|
Bowtie 2 will, by default, attempt to align unpaired BAM reads. Use this option to align paired-end reads instead. |
|
Preserve tags from the original BAM record by appending them to the end of the corresponding Bowtie 2 SAM output. |
Output options
|
Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. Default: off. |
|
Write unpaired reads that fail to align to file at
|
|
Write unpaired reads that align at least once to file at
|
|
Write paired-end reads that fail to align concordantly to file(s) at
|
|
Write paired-end reads that align concordantly at least once to
file(s) at |
|
Print nothing besides alignments and serious errors. |
|
Write |
|
Write |
|
Write a new |
SAM options
|
Suppress SAM records for reads that failed to align. |
|
Suppress SAM header lines (starting with |
|
Suppress |
|
Set the read group ID to |
|
Add |
|
When printing secondary alignments, Bowtie 2 by default will write
out the |
|
Consider soft-clipped bases unmapped when calculating
|
|
Suppress standard behavior of truncating readname at first whitespace at the expense of generating non-standard SAM |
|
Use |
|
Append FASTA/FASTQ comment to SAM record, where a comment is everything after the first space in the read name. |
Performance options
|
Override the offrate of the index with |
|
Launch |
|
Guarantees that output SAM records are printed in an order
corresponding to the order of the reads in the original input file, even
when |
|
Use memory-mapped I/O to load the index, rather than typical file
I/O. Memory-mapping allows many concurrent |
Other options
|
Filter out reads for which the QSEQ filter field is non-zero. Only
has an effect when read format is |
|
Use |
|
Normally, Bowtie 2 re-initializes its pseudo-random generator for
each read. It seeds the generator with a number derived from (a) the
read name, (b) the nucleotide sequence, (c) the quality sequence, (d)
the value of the |
|
Print version information and quit. |
|
Print usage information and quit. |
SAM output
Following is a brief description of the SAM format as output
by bowtie2
. For more details, see the SAM format
specification.
By default, bowtie2
prints a SAM header with
@HD
, @SQ
and @PG
lines. When one
or more --rg
arguments
are specified, bowtie2
will also print an @RG
line that includes all user-specified --rg
tokens separated by
tabs.
Each subsequent line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are:
Name of read that aligned.
Note that the SAM specification disallows whitespace in the read name. If the read name contains any whitespace characters, Bowtie 2 will truncate the name at the first whitespace character. This is similar to the behavior of other tools. The standard behavior of truncating at the first whitespace can be suppressed with
--sam-no-qname-trunc
at the expense of generating non-standard SAM.Sum of all applicable flags. Flags relevant to Bowtie are:
1
The read is one of a pair
2
The alignment is one end of a proper paired-end alignment
4
The read has no reported alignments
8
The read is one of a pair and has no reported alignments
16
The alignment is to the reverse reference strand
32
The other mate in the paired-end alignment is aligned to the reverse reference strand
64
The read is mate 1 in a pair
128
The read is mate 2 in a pair
Thus, an unpaired read that aligns to the reverse reference strand will have flag 16. A paired-end read that aligns and is the first mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).
Name of reference sequence where alignment occurs
1-based offset into the forward reference strand where leftmost character of the alignment occurs
Mapping quality
CIGAR string representation of alignment
Name of reference sequence where mate's alignment occurs. Set to
=
if the mate's reference sequence is the same as this alignment's, or*
if there is no mate.1-based offset into the forward reference strand where leftmost character of the mate's alignment occurs. Offset is 0 if there is no mate.
Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome.
Read sequence (reverse-complemented if aligned to the reverse strand)
ASCII-encoded read qualities (reverse-complemented if the read aligned to the reverse strand). The encoded quality values are on the Phred quality scale and the encoding is ASCII-offset by 33 (ASCII char
!
), similarly to a FASTQ file.Optional fields. Fields are tab-separated.
bowtie2
outputs zero or more of these optional fields for each alignment, depending on the type of the alignment:
|
Alignment score. Can be negative. Can be greater than 0 in |
|
Alignment score for the best-scoring alignment found other than the
alignment reported. Can be negative. Can be greater than 0 in |
|
Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment. |
|
The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read. |
|
The number of mismatches in the alignment. Only present if SAM record is for an aligned read. |
|
The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read. |
|
The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read. |
|
The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read. |
|
String indicating reason why the read was filtered out. See also: Filtering. Only appears for reads that were filtered out. |
|
Value of |
|
A string representation of the mismatched reference bases in the alignment. See SAM Tags format specification for details. Only present if SAM record is for an aligned read. |
The bowtie2-build
indexer
bowtie2-build
builds a Bowtie index from a set of DNA
sequences. bowtie2-build
outputs a set of 6 files with
suffixes .1.bt2
, .2.bt2
, .3.bt2
,
.4.bt2
, .rev.1.bt2
, and
.rev.2.bt2
. In the case of a large index these suffixes
will have a bt2l
termination. These files together
constitute the index: they are all that is needed to align reads to that
reference. The original sequence FASTA
files
are no longer used by Bowtie 2 once the index is built.
Bowtie 2's .bt2
index format is different from Bowtie
1's .ebwt
format, and they are not compatible with each
other.
Use of Karkkainen's blockwise
algorithm allows bowtie2-build
to trade off between
running time and memory usage. bowtie2-build
has three
options governing how it makes this trade: -p
/--packed
,
--bmax
/--bmaxdivn
, and
--dcv
. By default,
bowtie2-build
will automatically search for the settings
that yield the best running time without exhausting memory. This
behavior can be disabled using the -a
/--noauto
option.
The indexer provides options pertaining to the "shape" of the index,
e.g. --offrate
governs the fraction of Burrows-Wheeler
rows that are "marked" (i.e., the density of the suffix-array sample;
see the original FM Index paper
for details). All of these options are potentially profitable trade-offs
depending on the application. They have been set to defaults that are
reasonable for most cases according to our experiments. See Performance tuning for details.
bowtie2-build
can generate either small or large indexes. The wrapper
will decide which based on the length of the input genome. If the
reference does not exceed 4 billion characters but a large index is
preferred, the user can specify --large-index
to force bowtie2-build
to build a large index instead.
The Bowtie 2 index is based on the FM Index of Ferragina and Manzini, which in turn is based on the Burrows-Wheeler transform. The algorithm used to build the index is based on the blockwise algorithm of Karkkainen.
Command Line
Usage:
bowtie2-build [options]* <reference_in> <bt2_base>
Main arguments
|
A comma-separated list of |
|
The basename of the index files to write. By default,
|
Options
|
The reference input files (specified as
|
|
The reference sequences are given on the command line. I.e.
|
|
Force |
|
Disable the default behavior whereby |
|
Use a packed (2-bits-per-nucleotide) representation for DNA strings.
This saves memory but makes indexing 2-3 times slower. Default: off.
This is configured automatically by default; use |
|
The maximum number of suffixes allowed in a block. Allowing more
suffixes per block makes indexing faster, but increases peak memory
usage. Setting this option overrides any previous setting for |
|
The maximum number of suffixes allowed in a block, expressed as a
fraction of the length of the reference. Setting this option overrides
any previous setting for |
|
Use |
|
Disable use of the difference-cover sample. Suffix sorting becomes quadratic-time in the worst case (where the worst case is an extremely repetitive reference). Default: off. |
|
Do not build the |
|
Build only the |
|
To map alignments back to positions on the reference sequences, it's
necessary to annotate ("mark") some or all of the Burrows-Wheeler
rows with their corresponding location on the genome. |
|
The ftab is the lookup table used to calculate an initial Burrows-Wheeler
range with respect to the first |
|
Use |
|
Index only the first |
|
|
|
By default |
|
Print usage information and quit. |
|
Print version information and quit. |
The
bowtie2-inspect
index inspector
bowtie2-inspect
extracts information from a Bowtie index
about what kind of index it is and what reference sequences were used to
build it. When run without any options, the tool will output a FASTA
file
containing the sequences of the original references (with all
non-A
/C
/G
/T
characters converted to N
s). It can also be used to extract
just the reference sequence names using the -n
/--names
option or a more verbose summary using the -s
/--summary
option.
Command Line
Usage:
bowtie2-inspect [options]* <bt2_base>
Main arguments
|
The basename of the index to be inspected. The basename is name of
any of the index files but with the |
Options
|
When printing |
|
Print reference sequence names, one per line, and quit. |
|
Print a summary that includes information about index settings, as well as the names and lengths of the input sequences. The summary has this format:
Fields are separated by tabs. Colorspace is always set to 0 for Bowtie 2. |
|
Save output to user-specified filename (default: stdout) |
|
Print verbose output (for debugging). |
|
Print version information and quit. |
|
Print usage information and quit. |
Getting started with Bowtie 2: Lambda phage example
Bowtie 2 comes with some example files to get you started. The example files are not scientifically significant; we use the Lambda phage reference genome simply because it's short, and the reads were generated by a computer program, not a sequencer. However, these files will let you start running Bowtie 2 and downstream tools right away.
First follow the manual instructions to obtain Bowtie 2. Set the
BT2_HOME
environment variable to point to the new Bowtie 2
directory containing the bowtie2
,
bowtie2-build
and bowtie2-inspect
binaries.
This is important, as the BT2_HOME
variable is used in the
commands below to refer to that directory.
Indexing a reference genome
To create an index for the Lambda phage reference genome included with Bowtie 2, create a new temporary directory (it doesn't matter where), change into that directory, and run:
$BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virus
The command should print many lines of output then quit. When the
command completes, the current directory will contain four new files
that all start with lambda_virus
and end with
.1.bt2
, .2.bt2
, .3.bt2
,
.4.bt2
, .rev.1.bt2
, and
.rev.2.bt2
. These files constitute the index - you're
done!
You can use bowtie2-build
to create an index for a set
of FASTA
files obtained from any source, including sites such as UCSC, NCBI, and Ensembl. When indexing multiple FASTA
files,
specify all the files using commas to separate file names. For more
details on how to create an index with bowtie2-build
, see
the manual section on index
building. You may also want to bypass this process by obtaining a
pre-built index. See using a
pre-built index below for an example.
Aligning example reads
Stay in the directory created in the previous step, which now
contains the lambda_virus
index files. Next, run:
$BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.sam
This runs the Bowtie 2 aligner, which aligns a set of unpaired reads
to the Lambda
phage reference genome using the index generated in the previous
step. The alignment results in SAM format are written to the file
eg1.sam
, and a short alignment summary is written to the
console. (Actually, the summary is written to the "standard error" or
"stderr" filehandle, which is typically printed to the console.)
To see the first few lines of the SAM output, run:
head eg1.sam
You will see something like this:
@HD VN:1.0 SO:unsorted
@SQ SN:gi|9626243|ref|NC_001416.1| LN:48502
@PG ID:bowtie2 PN:bowtie2 VN:2.0.1
r1 0 gi|9626243|ref|NC_001416.1| 18401 42 122M * 0 0 TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG +"@6<:27(F&5)9"B):%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C> AS:i:-5 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:59G13G21G26 YT:Z:UU
r2 0 gi|9626243|ref|NC_001416.1| 8886 42 275M * 0 0 NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC (#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-14 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU
r3 16 gi|9626243|ref|NC_001416.1| 11599 42 338M * 0 0 GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT 7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?�.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6 AS:i:-22 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:80C4C16A52T23G30A8T76A41 YT:Z:UU
r4 0 gi|9626243|ref|NC_001416.1| 40075 42 184M * 0 0 GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGT(=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:77C106 YT:Z:UU
r5 0 gi|9626243|ref|NC_001416.1| 48010 42 138M * 0 0 GTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTT 9''%<D)A03E1-*7=),:F/0!6,D9:H,<9D%:0B(%'E,(8EFG$E89B$27G8F*2+4,-!,0D5()&=(FGG:5;3*@/.0F-G#5#3->('FDFEG?)5.!)"AGADB3?6(@H(:B<>6!>;>6>G,."?% AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:138 YT:Z:UU
r6 16 gi|9626243|ref|NC_001416.1| 41607 42 72M2D119M * 0 0 TCGATTTGCAAATACCGGAACATCTCGGTAACTGCATATTCTGCATTAAAAAATCAACGCAAAAAATCGGACGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATNCCATGTGCGTGACGGNCATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT 1H#G;H"$E*E#&"*)2%66?=9/9'=;4)4/>@%+5#@#$4A*!<D=="8#1*A9BA=:(1+#C&.#(3#H=9E)AC*5,AC#E'536*2?)H14?>9'B=7(3H/B:+A:8%1-+#(E%&$$&14"76D?>7(&20H5%*&CF8!G5B+A4F$7(:"'?0$?G+$)B-?2<0<F=D!38BH,%=8&5@+ AS:i:-13 XN:i:0 XM:i:2 XO:i:1 XG:i:2 NM:i:4 MD:Z:72^TT55C15A47 YT:Z:UU
r7 16 gi|9626243|ref|NC_001416.1| 4692 42 143M * 0 0 TCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACAGCATTCTGCTCGATATGGACANGCCCGGCGGGATGGTGGCGGGG -"/@*7A0)>2,AAH@&"%B)*5*23B/,)90.B@%=FE,E063C9?,:26$-0:,.,1849'4.;F>FA;76+5&$<C":$!A*,<B,<)@<'85D%C*:)30@85;?.B$05=@95DCDH<53!8G:F:B7/A.E':434> AS:i:-6 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:98G21C22 YT:Z:UU
The first few lines (beginning with @
) are SAM header
lines, and the rest of the lines are SAM alignments, one line per read
or mate. See the Bowtie 2 manual section on SAM
output and the SAM specification
for details about how to interpret the SAM file format.
Paired-end example
To align paired-end reads included with Bowtie 2, stay in the same directory and run:
$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam
This aligns a set of paired-end reads to the reference genome, with
results written to the file eg2.sam
.
Local alignment example
To use local alignment to align some longer reads included with Bowtie 2, stay in the same directory and run:
$BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.sam
This aligns the long reads to the reference genome using local
alignment, with results written to the file eg3.sam
.
Using SAMtools/BCFtools downstream
SAMtools is a
collection of tools for manipulating and analyzing SAM and BAM alignment
files. BCFtools is a
collection of tools for calling variants and manipulating VCF and BCF
files, and it is typically distributed with SAMtools. Using these tools
together allows you to get from alignments in SAM format to variant
calls in VCF format. This example assumes that samtools
and
bcftools
are installed and that the directories containing
these binaries are in your PATH environment
variable.
Run the paired-end example:
$BT2_HOME/bowtie2 -x $BT2_HOME/example/index/lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam
Use samtools view
to convert the SAM file into a BAM
file. BAM is the binary format corresponding to the SAM text format.
Run:
samtools view -bS eg2.sam > eg2.bam
Use samtools sort
to convert the BAM file to a sorted
BAM file.
samtools sort eg2.bam -o eg2.sorted.bam
We now have a sorted BAM file called eg2.sorted.bam
.
Sorted BAM is a useful format because the alignments are (a) compressed,
which is convenient for long-term storage, and (b) sorted, which is
conveneint for variant discovery. To generate variant calls in VCF
format, run:
bcftools mpileup -f $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -Ov - > eg2.raw.bcf
Then to view the variants, run:
bcftools view eg2.raw.bcf
See the official SAMtools guide to Calling SNPs/INDELs with SAMtools/BCFtools for more details and variations on this process.