Bowtie 2

Fast and sensitive read alignment

Site Map

Latest Release

Bowtie2 2.1.0 2/21/13 

Please cite: Langmead B, Salzberg S. Fast gapped-read alignment with Bowtie 2. Nature Methods. 2012, 9:357-359.

Related Tools

Bowtie: Ultrafast short read alignment
Crossbow: Genotyping, cloud computing
Myrna: Cloud, differential gene expression
Tophat: RNA-Seq splice junction mapper
Cufflinks: Isoform assembly, quantitation

Indexes

H. sapiens, UCSC hg18 3.5 GB
 or: part 1 (1.5 GB), part 2 (651 MB), part 3 (1.5 GB)
H. sapiens, UCSC hg19 3.5 GB
 or: part 1 (1.5 GB), part 2 (650 MB), part 3 (1.5 GB)
M. musculus, UCSC mm10 3.2 GB
 or: part 1 (1.3 GB), part 2 (600 MB), part 3 (1.3 GB)
M. musculus, UCSC mm9 3.2 GB
 or: part 1 (1.3 GB), part 2 (593 MB), part 3 (1.3 GB)
R. norvegicus, UCSC rn4 3.1 GB
 or: part 1 (1.3 GB), part 2 (580 MB), part 3 (1.3 GB)

Some unzip programs cannot handle archives >2 GB. If you have problems downloading or unzipping a >2 GB index, try downloading in parts.

Related publications

Author

Other Documentation

  • Bio. of Genomes poster, 5/11 (.ppt, .pdf)

Links

Table of Contents

 Version 2.1.0

Bowtie 2 Manual -

Introduction

What is Bowtie 2?

Bowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index (based on the Burrows-Wheeler Transform or BWT) to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple processors can be used simultaneously to achieve greater alignment speed. Bowtie 2 outputs alignments in SAM format, enabling interoperation with a large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie 2 is distributed under the GPLv3 license, and it runs on the command line under Windows, Mac OS X and Linux.

Bowtie 2 is often the first step in pipelines for comparative genomics, including for variation calling, ChIP-seq, RNA-seq, BS-seq. Bowtie 2 and Bowtie (also called "Bowtie 1" here) are also tightly integrated into some tools, including TopHat: a fast splice junction mapper for RNA-seq reads, Cufflinks: a tool for transcriptome assembly and isoform quantitiation from RNA-seq reads, Crossbow: a cloud-enabled software tool for analyzing reseuqncing data, and Myrna: a cloud-enabled software tool for aligning RNA-seq reads and measuring differential gene expression.

If you use Bowtie 2 for your published research, please cite the Bowtie paper. Thank you!

How is Bowtie 2 different from Bowtie 1?

Bowtie 1 was released in 2009 and was geared toward aligning the relatively short sequencing reads (up to 25-50 nucleotides) prevalent at the time. Since then, technology has improved both sequencing throughput (more nucleotides produced per sequencer per day) and read length (more nucleotides per read).

The chief differences between Bowtie 1 and Bowtie 2 are:

  1. For reads longer than about 50 bp Bowtie 2 is generally faster, more sensitive, and uses less memory than Bowtie 1. For relatively short reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or more sensitive.

  2. Bowtie 2 supports gapped alignment with affine gap penalties. Number of gaps and gap lengths are not restricted, except by way of the configurable scoring scheme. Bowtie 1 finds just ungapped alignments.

  3. Bowtie 2 supports local alignment, which doesn't require reads to align end-to-end. Local alignments might be "trimmed" ("soft clipped") at one or both extremes in a way that optimizes alignment score. Bowtie 2 also supports end-to-end alignment which, like Bowtie 1, requires that the read align entirely.

  4. There is no upper limit on read length in Bowtie 2. Bowtie 1 had an upper limit of around 1000 bp.

  5. Bowtie 2 allows alignments to overlap ambiguous characters (e.g. Ns) in the reference. Bowtie 1 does not.

  6. Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", and its distinction between "Maq-like" and "end-to-end" modes. In Bowtie 2 all alignments lie along a continuous spectrum of alignment scores where the scoring scheme, similar to Needleman-Wunsch and Smith-Waterman.

  7. Bowtie 2's paired-end alignment is more flexible. E.g. for pairs that do not align in a paired fashion, Bowtie 2 attempts to find unpaired alignments for each mate.

  8. Bowtie 2 reports a spectrum of mapping qualities, in contrast fo Bowtie 1 which reports either 0 or high.

  9. Bowtie 2 does not align colorspace reads.

Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's command-line arguments and genome index format are both different from Bowtie 1's.

What isn't Bowtie 2?

Bowtie 1 and Bowtie 2 are not general-purpose alignment tools like MUMmer, BLAST or Vmatch. Bowtie 2 works best when aligning to large genomes, though it supports arbitrarily small reference sequences (e.g. amplicons). It handles very long reads (i.e. upwards of 10s or 100s of kilobases), but it is optimized for the read lengths and error modes yielded by recent sequencers, such as the Illumina HiSeq 2000, Roche 454, and Ion Torrent instruments.

If your goal is to align two very large sequences (e.g. two genomes), consider using MUMmer. If your goal is very sensitive alignment to a relatively short reference sequence (e.g. a bacterial genome), this can be done with Bowtie 2 but you may want to consider using tools like NUCmer, BLAT, or BLAST. These tools can be extremely slow when the reference genome is long, but are often adequate when the reference is short.

Bowtie 2 does not support alignment of colorspace reads. This might be supported in future versions.

What does it mean that some older Bowtie 2 versions are "beta"?

We said those Bowtie 2 versions were in "beta" to convey that it was not as polished as a tool that had been around for a while, and was still in flux. Since version 2.0.1, we declared Bowtie 2 was no longer "beta".

Obtaining Bowtie 2

Download Bowtie 2 sources and binaries from the Download section of the Sourceforge site. Binaries are available for Intel architectures (i386 and x86_64) running Linux, and Mac OS X. A 32-bit version is available for Windows. If you plan to compile Bowtie 2 yourself, make sure to get the source package, i.e., the filename that ends in "-source.zip".

Building from source

Building Bowtie 2 from source requires a GNU-like environment with GCC, GNU Make and other basics. It should be possible to build Bowtie 2 on most vanilla Linux installations or on a Mac installation with Xcode installed. Bowtie 2 can also be built on Windows using Cygwin or MinGW (MinGW recommended). For a MinGW build the choice of what compiler is to be used is important since this will determine if a 32 or 64 bit code can be successfully compiled using it. If there is a need to generate both 32 and 64 bit on the same machine then a multilib MinGW has to be properly installed. MSYS, the zlib library, and depending on architecture pthreads library are also required. We are recommending a 64 bit build since it has some clear advantages in real life research problems. In order to simplify the MinGW setup it might be worth investigating popular MinGW personal builds since these are coming already prepared with most of the toolchains needed.

First, download the source package from the sourceforge site. Make sure you're getting the source package; the file downloaded should end in -source.zip. Unzip the file, change to the unzipped directory, and build the Bowtie 2 tools by running GNU make (usually with the command make, but sometimes with gmake) with no arguments. If building with MinGW, run make from the MSYS environment.

Bowtie 2 is using the multithreading software model in order to speed up execution times on SMP architectures where this is possible. On POSIX platforms (like linux, Mac OS, etc) it needs the pthread library. Although it is possible to use pthread library on non-POSIX platform like Windows, due to performance reasons bowtie 2 will try to use Windows native multithreading if possible.

Adding to PATH

By adding your new Bowtie 2 directory to your PATH environment variable, you ensure that whenever you run bowtie2, bowtie2-build or bowtie2-inspect from the command line, you will get the version you just installed without having to specify the entire path. This is recommended for most users. To do this, follow your operating system's instructions for adding the directory to your PATH.

If you would like to install Bowtie 2 by copying the Bowtie 2 executable files to an existing directory in your PATH, make sure that you copy all the executables, including bowtie2, bowtie2-align, bowtie2-build and bowtie2-inspect.

The bowtie2 aligner

bowtie2 takes a Bowtie 2 index and a set of sequencing read files and outputs a set of alignments in SAM format.

"Alignment" is the process by which we discover how and where the read sequences are similar to the reference sequence. An "alignment" is a result from this process, specifically: an alignment is a way of "lining up" some or all of the characters in the read with some characters from the reference in a way that reveals how they're similar. For example:

  Read:      GACTGGGCGATCTCGACTTCG
             |||||  |||||||||| |||
  Reference: GACTG--CGATCTCGACATCG

Where dash symbols represent gaps and vertical bars show where aligned characters match.

We use alignment to make an educated guess as to where a read originated with respect to the reference genome. It's not always possible to determine this with certainty. For instance, if the reference genome contains several long stretches of As (AAAAAAAAA etc) and the read sequence is a short stretch of As (AAAAAAA), we cannot know for certain exactly where in the sea of As the read originated.

End-to-end alignment versus local alignment

By default, Bowtie 2 performs end-to-end read alignment. That is, it searches for alignments involving all of the read characters. This is also called an "untrimmed" or "unclipped" alignment.

When the --local option is specified, Bowtie 2 performs local read alignment. In this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both ends of the alignment if doing so maximizes the alignment score.

End-to-end alignment example

The following is an "end-to-end" alignment because it involves all the characters in the read. Such an alignment can be produced by Bowtie 2 in either end-to-end mode or in local mode.

Read:      GACTGGGCGATCTCGACTTCG
Reference: GACTGCGATCTCGACATCG

Alignment:
  Read:      GACTGGGCGATCTCGACTTCG
             |||||  |||||||||| |||
  Reference: GACTG--CGATCTCGACATCG

Local alignment example

The following is a "local" alignment because some of the characters at the ends of the read do not participate. In this case, 4 characters are omitted (or "soft trimmed" or "soft clipped") from the beginning and 3 characters are omitted from the end. This sort of alignment can be produced by Bowtie 2 only in local mode.

Read:      ACGGTTGCGTTAATCCGCCACG
Reference: TAACTTGCGTTAAATCCGCCTGG

Alignment:
  Read:      ACGGTTGCGTTAA-TCCGCCACG
                 ||||||||| ||||||
  Reference: TAACTTGCGTTAAATCCGCCTGG

Scores: higher = more similar

An alignment score quantifies how similar the read sequence is to the reference sequence aligned to. The higher the score, the more similar they are. A score is calculated by subtracting penalties for each difference (mismatch, gap, etc) and, in local alignment mode, adding bonuses for each match.

The scores can be configured with the --ma (match bonus), --mp (mismatch penalty), --np (penalty for having an N in either the read or the reference), --rdg (affine read gap penalty) and --rfg (affine reference gap penalty) options.

End-to-end alignment score example

A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). Thus, in end-to-end alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score is -(6 + 11) = -17.

The best possible alignment score in end-to-end mode is 0, which happens when there are no differences between the read and the reference.

Local alignment score example

A mismatched base at a high-quality position in the read receives a penalty of -6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for the gap open, -3 for the first extension, -3 for the second extension). A base that matches receives a bonus of +2 be default. Thus, in local alignment mode, if the read is 50 bp long and it matches the reference exactly except for one mismatch at a high-quality position and one length-2 read gap, then the overall score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.

The best possible score in local mode equals the match bonus times the length of the read. This happens when there are no differences between the read and the reference.

Valid alignments meet or exceed the minimum score threshold

For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it must have an alignment score no less than the minimum score threshold. The threshold is configurable and is expressed as a function of the read length. In end-to-end alignment mode, the default minimum score threhsold is -0.6 + -0.6 * L, where L is the read length. In local alignment mdoe, the default minimum score threshold is 20 + 8.0 * ln(L), where L is the read length. This can be configured with the --score-min option. For details on how to set options like --score-min that correpond to functions, see the section on setting function options.

Mapping quality: higher = more unique

The aligner cannot always assign a read to its point of origin with high confidence. For instance, a read that originated inside a repeat element might align equally well to many occurrences of the element throughout the genome, leaving the aligner with no basis for preferring one over the others.

Aligners characterize their degree of confidence in the point of origin by reporting a mapping quality: a non-negative integer Q = -10 log10 p, where p is an estimate of the probability that the alignment does not correspond to the read's true point of origin. Mapping quality is sometimes abbreviated MAPQ, and is recorded in the SAM MAPQ field.

Mapping quality is related to "uniqueness." We say an alignment is unique if it has a much higher alignment score than all the other possible alignments. The bigger the gap between the best alignment's score and the second-best alignment's score, the more unique the best alignment, and the higher its mapping quality should be.

Accurate mapping qualities are useful for downstream tools like variant callers. For instance, a variant caller might choose to ignore evidence from alignments with mapping quality less than, say, 10. A mapping quality of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere.

Aligning pairs

A "paired-end" or "mate-pair" read consists of pair of mates, called mate 1 and mate 2. Pairs come with a prior expectation about (a) the relative orientation of the mates, and (b) the distance separating them on the original DNA molecule. Exactly what expectations hold for a given dataset depends on the lab procedures used to generate the data. For example, a common lab procedure for producing pairs is Illumina's Paired-end Sequencing Assay, which yields pairs with a relative orientation of FR ("forward, reverse") meaning that if mate 1 came from the Watson strand, mate 2 very likely came from the Crick strand and vice versa. Also, this protocol yields pairs where the expected genomic distance from end to end is about 200-500 base pairs.

For simplicity, this manual uses the term "paired-end" to refer to any pair of reads with some expected relative orientation and distance. Depending on the protocol, these might actually be referred to as "paired-end" or "mate-paired." Also, we always refer to the individual sequences making up the pair as "mates."

Paired inputs

Pairs are often stored in a pair of files, one file containing the mate 1s and the other containing the mates 2s. The first mate in the file for mate 1 forms a pair with the first mate in the file for mate 2, the second with the second, and so on. When aligning pairs with Bowtie 2, specify the file with the mate 1s mates using the -1 argument and the file with the mate 2s using the -2 argument. This causes Bowtie 2 to take the paired nature of the reads into account when aligning them.

Paired SAM output

When Bowtie 2 prints a SAM alignment for a pair, it prints two records (i.e. two lines of output), one for each mate. The first record describes the alignment for mate 1 and the second record describes the alignment for mate 2. In both records, some of the fields of the SAM record describe various properties of the alignment; for instance, the 7th and 8th fields (RNEXT and PNEXT respectively) indicate the reference name and position where the other mate aligned, and the 9th field indicates the inferred length of the DNA fragment from which the two mates were sequenced. See the SAM specification for more details regarding these fields.

Concordant pairs match pair expectations, discordant pairs don't

A pair that aligns with the expected relative mate orientation and with the expected range of distances between mates is said to align "concordantly". If both mates have unique alignments, but the alignments do not match paired-end expectations (i.e. the mates aren't in the expcted relative orientation, or aren't within the expected disatance range, or both), the pair is said to align "discordantly". Discordant alignments may be of particular interest, for instance, when seeking structural variants.

The expected relative orientation of the mates is set using the --ff, --fr, or --rf options. The expected range of inter-mates distances (as measured from the furthest extremes of the mates; also called "outer distance") is set with the -I and -X options. Note that setting -I and -X far apart makes Bowtie 2 slower. See documentation for -I and -X.

To declare that a pair aligns discordantly, Bowtie 2 requires that both mates align uniquely. This is a conservative threshold, but this is often desirable when seeking structural variants.

By default, Bowtie 2 searches for both concordant and discordant alignments, though searching for discordant alignments can be disabled with the --no-discordant option.

Mixed mode: paired where possible, unpaired otherwise

If Bowtie 2 cannot find a paired-end alignment for a pair, by default it will go on to look for unpaired alignments for the constituent mates. This is called "mixed mode." To disable mixed mode, set the --no-mixed option.

Bowtie 2 runs a little faster in --no-mixed mode, but will only consider alignment status of pairs per se, not individual mates.

Some SAM FLAGS describe paired-end properties

The SAM FLAGS field, the second field in a SAM record, has multiple bits that describe the paired-end nature of the read and alignment. The first (least significant) bit (1 in decimal, 0x1 in hexidecimal) is set if the read is part of a pair. The second bit (2 in decimal, 0x2 in hexidecimal) is set if the read is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexidecimal) is set if the read is part of a pair and the other mate in the pair had at least one valid alignment. The sixth bit (32 in decimal, 0x20 in hexidecimal) is set if the read is part of a pair and the other mate in the pair aligned to the Crick strand (or, equivalently, if the reverse complement of the other mate aligned to the Watson strand). The seventh bit (64 in decimal, 0x40 in hexidecimal) is set if the read is mate 1 in a pair. The eighth bit (128 in decimal, 0x80 in hexidecimal) is set if the read is mate 2 in a pair. See the SAM specification for a more detailed description of the FLAGS field.

Some SAM optional fields describe more paired-end properties

The last severeal fields of each SAM record usually contain SAM optional fields, which are simply tab-separated strings conveying additional information about the reads and alignments. A SAM optional field is formatted like this: "XP:i:1" where "XP" is the TAG, "i" is the TYPE ("integer" in this case), and "1" is the VALUE. See the SAM specification for details regarding SAM optional fields.

Mates can overlap, contain, or dovetail each other

The fragment and read lengths might be such that alignments for the two mates from a pair overlap each other. Consider this example:

(For these examples, assume we expect mate 1 to align to the left of mate 2.)

Mate 1:    GCAGATTATATGAGTCAGCTACGATATTGTT
Mate 2:                               TGTTTGGGGTGACACATTACGCGTCTTTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

It's also possible, though unusual, for one mate alignment to contain the other, as in these examples:

Mate 1:    GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2:                               TGTTTGGGGTGACACATTACGC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

Mate 1:                   CAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2:                      CTACGATATTGTTTGGGGTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

And it's also possible, though unusual, for the mates to "dovetail", with the mates seemingly extending "past" each other as in this example:

Mate 1:                 GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2:            TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT                   
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

In some situations, it's desirable for the aligner to consider all these cases as "concordant" as long as other paired-end constraints are not violated. Bowtie 2's default behavior is to consider overlapping and containing as being consistent with concordant alignment. By default, dovetailing is considered inconsistent with concordant alignment.

These defaults can be overridden. Setting --no-overlap causes Bowtie 2 to consider overlapping mates as non-concordant. Setting --no-contain causes Bowtie 2 to consider cases where one mate alignment contains the other as non-concordant. Setting --dovetail causes Bowtie 2 to consider cases where the mate alignments dovetail as concordant.

Reporting

The reporting mode governs how many alignments Bowtie 2 looks for, and how to report them. Bowtie 2 has three distinct reporting modes. The default reporting mode is similar to the default reporting mode of many other read alignment tools, including BWA. It is also similar to Bowtie 1's -M alignment mode.

In general, when we say that a read has an alignment, we mean that it has a valid alignment. When we say that a read has multiple alignments, we mean that it has multiple alignments that are valid and distinct from one another.

Distinct alignments map a read to different places

Two alignments for the same individual read are "distinct" if they map the same read to different places. Specifically, we say that two alignments are distinct if there are no alignment positions where a particular read offset is aligned opposite a particular reference offset in both alignments with the same orientation. E.g. if the first alignment is in the forward orientation and aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, and the second alignment is also in the forward orientation and also aligns the read character at read offset 10 to the reference character at chromosome 3, offset 3,445,245, they are not distinct alignments.

Two alignments for the same pair are distinct if either the mate 1s in the two paired-end alignments are distinct or the mate 2s in the two alignments are distinct or both.

Default mode: search for multiple alignments, report the best one

By default, Bowtie 2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it generally will continue to look for alignments that are nearly as good or better. It will eventually stop looking, either because it exceeded a limit placed on search effort (see -D and -R) or because it already knows all it needs to know to report an alignment. Information from the best alignments are used to estimate mapping quality (the MAPQ SAM field) and to set SAM optional fields, such as AS:i and XS:i. Bowtie 2 does not gaurantee that the alignment reported is the best possible in terms of alignment score.

See also: -D, which puts an upper limit on the number of dynamic programming problems (i.e. seed extensions) that can "fail" in a row before Bowtie 2 stops searching. Increasing -D makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.

See also: -R, which sets the maximum number of times Bowtie 2 will "re-seed" when attempting to align a read with repetitive seeds. Increasing -R makes Bowtie 2 slower, but increases the likelihood that it will report the correct alignment for a read that aligns many places.

-k mode: search for one or more alignments, report each

In -k mode, Bowtie 2 searches for up to N distinct, valid alignments for each read, where N equals the integer specified with the -k parameter. That is, if -k 2 is specified, Bowtie 2 will search for at most 2 distinct alignments. It reports all alignments found, in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. See the SAM specification for details.

Bowtie 2 does not "find" alignments in any specific order, so for reads that have more than N distinct, valid alignments, Bowtie 2 does not gaurantee that the N alignments reported are the best possible in terms of alignment score. Still, this mode can be effective and fast in situations where the user cares more about whether a read aligns (or aligns a certain number of times) than where exactly it originated.

-a mode: search for and report all alignments

-a mode is similar to -k mode except that there is no upper limit on the number of alignments Bowtie 2 should report. Alignments are reported in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. See the SAM specification for details.

Some tools are designed with this reporting mode in mind. Bowtie 2 is not! For very large genomes, this mode is very slow.

Randomness in Bowtie 2

Bowtie 2's search for alignments for a given read is "randomized." That is, when Bowtie 2 encouters a set of equally-good choices, it uses a pseudo-random number to choose. For example, if Bowtie 2 discovers a set of 3 equally-good alignments and wants to decide which to report, it picks a pseudo-random integer 0, 1 or 2 and reports the corresponding alignment. Abitrary choices can crop up at various points during alignment.

The pseudo-random number generator is re-initialized for every read, and the seed used to initialize it is a function of the read name, nucleotide string, quality string, and the value specified with --seed. If you run the same version of Bowtie 2 on two reads with identical names, nucleotide strings, and quality strings, and if --seed is set the same for both runs, Bowtie 2 will produce the same output; i.e., it will align the read to the same place, even if there are multiple equally good alignments. This is intuitive and desirable in most cases. Most users expect Bowtie to produce the same output when run twice on the same input.

However, when the user specifies the --non-deterministic option, Bowtie 2 will use the current time to re-intiailize the pseud-random number generator. When this is specified, Bowtie 2 might report different alignments for identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.

Multiseed heuristic

To rapidly narrow the number of possible alignments that must be considered, Bowtie 2 begins by extracting substrings ("seeds") from the read and its reverse complement and aligning them in an ungapped fashion with the help of the FM Index. This is "multiseed alignment" and it is similar to what Bowtie 1 does, except Bowtie 1 attempts to align the entire read this way.

This initial step makes Bowtie 2 much faster than it would be without such a filter, but at the expense of missing some valid alignments. For instance, it is possible for a read to have a valid overall alignment but to have no valid seed alignments because each potential seed alignment is interruped by too many mismatches or gaps.

The tradeoff between speed and sensitivity/accuracy can be adjusted by setting the seed length (-L), the interval between extracted seeds (-i), and the number of mismatches permitted per seed (-N). For more sensitive alignment, set these parameters to (a) make the seeds closer together, (b) make the seeds shorter, and/or (c) allow more mismatches. You can adjust these options one-by-one, though Bowtie 2 comes with some useful combinations of options pre-packaged as "preset options."

-D and -R are also options that adjust the tradeoff between speed and sensitivity/accuracy.

FM Index memory footprint

Bowtie 2 uses the FM Index to find ungapped alignments for seeds. This step accounts for the bulk of Bowtie 2's memory footprint, as the FM Index itself is typically the largest data structure used. For instance, the memory footprint of the FM Index for the human genome is about 3.2 gigabytes of RAM.

Ambiguous characters

Non-whitespace characters besides A, C, G or T are considered "ambiguous." N is a common ambiguous character that appears in reference sequences. Bowtie 2 considers all ambiguous characters in the reference (including IUPAC nucleotide codes) to be Ns.

Bowtie 2 allows alignments to overlap ambiguous characters in the reference. An alignment position that contains an ambiguous character in the read, reference, or both, is penalized according to --np. --n-ceil sets an upper limit on the number of positions that may contain ambiguous reference characters in a valid alignment. The optional field XN:i reports the number of ambiguous reference characters overlapped by an alignment.

Note that the multiseed heuristic cannot find seed alignments that overlap ambiguous reference characters. For an alignment overlapping an ambiguous reference character to be found, it must have one or more seed alignments that do not overlap ambiguous reference characters.

Presets: setting many settings at once

Bowtie 2 comes with some useful combinations of parameters packaged into shorter "preset" parameters. For example, running Bowtie 2 with the --very-sensitive option is the same as running with options: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50. The preset options that come with Bowtie 2 are designed to cover a wide area of the speed/sensitivity/accuracy tradeoff space, with the presets ending in fast generally being faster but less sensitive and less accurate, and the presets ending in sensitive generally being slower but more sensitive and more accurate. See the documentation for the preset options for details.

Filtering

Some reads are skipped or "filtered out" by Bowtie 2. For example, reads may be filtered out because they are extremely short or have a high proportion of ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read, but no alignment will be reported and and the YF:i SAM optional field will be set to indicate the reason the read was filtered.

  • YF:Z:LN: the read was filtered becuase it had length less than or equal to the number of seed mismatches set with the -N option.
  • YF:Z:NS: the read was filtered because it contains a number of ambiguous characters (usually N or .) greater than the ceiling specified with --n-ceil.
  • YF:Z:SC: the read was filtered because the read length and the match bonus (set with --ma) are such that the read can't possibly earn an alignment score greater than or equal to the threshold set with --score-min
  • YF:Z:QC: the read was filtered because it was marked as failing quality control and the user specified the --qc-filter option. This only happens when the input is in Illumina's QSEQ format (i.e. when --qseq is specified) and the last (11th) field of the read's QSEQ record contains 1.

If a read could be filtered for more than one reason, the value YF:Z flag will reflect only one of those reasons.

Alignment summmary

When Bowtie 2 finishes running, it prints messages summarizing what happened. These messages are printed to the "standard error" ("stderr") filehandle. For datasets consisting of unpaired reads, the summary might look like this:

20000 reads; of these:
  20000 (100.00%) were unpaired; of these:
    1247 (6.24%) aligned 0 times
    18739 (93.69%) aligned exactly 1 time
    14 (0.07%) aligned >1 times
93.77% overall alignment rate

For datasets consisting of pairs, the summary might look like this:

10000 reads; of these:
  10000 (100.00%) were paired; of these:
    650 (6.50%) aligned concordantly 0 times
    8823 (88.23%) aligned concordantly exactly 1 time
    527 (5.27%) aligned concordantly >1 times
    ----
    650 pairs aligned concordantly 0 times; of these:
      34 (5.23%) aligned discordantly 1 time
    ----
    616 pairs aligned 0 times concordantly or discordantly; of these:
      1232 mates make up the pairs; of these:
        660 (53.57%) aligned 0 times
        571 (46.35%) aligned exactly 1 time
        1 (0.08%) aligned >1 times
96.70% overall alignment rate

The indentation indicates how subtotals relate to totals.

Wrapper

The bowtie2 executable is actually a Perl wrapper script that calls the compiled bowtie2-align binary. It is recommended that you always run the bowtie2 wrapper and not run bowtie2-align directly.

Performance tuning

  1. Use 64-bit version if possible

    The 64-bit version of Bowtie 2 is faster than the 32-bit version, owing to its use of 64-bit arithmetic. If possible, download the 64-bit binaries for Bowtie 2 and run on a 64-bit computer. If you are building Bowtie 2 from sources, you may need to pass the -m64 option to g++ to compile the 64-bit version; you can do this by including BITS=64 in the arguments to the make command; e.g.: make BITS=64 bowtie2. To determine whether your version of bowtie is 64-bit or 32-bit, run bowtie2 --version.

  2. If your computer has multiple processors/cores, use -p

    The -p option causes Bowtie 2 to launch a specified number of parallel search threads. Each thread runs on a different processor/core and all threads find alignments in parallel, increasing alignment throughput by approximately a multiple of the number of threads (though in practice, speedup is somewhat worse than linear).

Command Line

Setting function options

Some Bowtie 2 options specify a function rather than an individual number or setting. In these cases the user specifies three parameters: (a) a function type F, (b) a constant term B, and (c) a coefficient A. The available function types are constant (C), linear (L), square-root (S), and natural log (G). The parameters are specified as F,B,A - that is, the function type, the constant term, and the coefficient are separated by commas with no whitespace. The constant term and coefficient may be negative and/or floating-point numbers.

For example, if the function specification is L,-0.4,-0.6, then the function defined is:

f(x) = -0.4 + -0.6 * x

If the function specification is G,1,5.4, then the function defined is:

f(x) = 1.0 + 5.4 * ln(x)

See the documentation for the option in question to learn what the parameter x is for. For example, in the case if the --score-min option, the function f(x) sets the minimum alignment score necessary for an alignment to be considered valid, and x is the read length.

Usage

bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r>} -S [<hit>]

Main arguments

-x <bt2-idx>

The basename of the index for the reference genome. The basename is the name of any of the index files up to but not including the final .1.bt2 / .rev.1.bt2 / etc. bowtie2 looks for the specified index first in the current directory, then in the directory specified in the BOWTIE2_INDEXES environment variable.

-1 <m1>

Comma-separated list of files containing mate 1s (filename usually includes _1), e.g. -1 flyA_1.fq,flyB_1.fq. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in <m2>. Reads may be a mix of different lengths. If - is specified, bowtie2 will read the mate 1s from the "standard in" or "stdin" filehandle.

-2 <m2>

Comma-separated list of files containing mate 2s (filename usually includes _2), e.g. -2 flyA_2.fq,flyB_2.fq. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in <m1>. Reads may be a mix of different lengths. If - is specified, bowtie2 will read the mate 2s from the "standard in" or "stdin" filehandle.

-U <r>

Comma-separated list of files containing unpaired reads to be aligned, e.g. lane1.fq,lane2.fq,lane3.fq,lane4.fq. Reads may be a mix of different lengths. If - is specified, bowtie2 gets the reads from the "standard in" or "stdin" filehandle.

-S <hit>

File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console).

Options

Input options

-q

Reads (specified with <m1>, <m2>, <s>) are FASTQ files. FASTQ files usually have extension .fq or .fastq. FASTQ is the default format. See also: --solexa-quals and --int-quals.

--qseq

Reads (specified with <m1>, <m2>, <s>) are QSEQ files. QSEQ files usually end in _qseq.txt. See also: --solexa-quals and --int-quals.

-f

Reads (specified with <m1>, <m2>, <s>) are FASTA files. FASTA files usually have extension .fa, .fasta, .mfa, .fna or similar. FASTA files do not have a way of specifying quality values, so when -f is set, the result is as if --ignore-quals is also set.

-r

Reads (specified with <m1>, <m2>, <s>) are files with one input sequence per line, without any other information (no read names, no qualities). When -r is set, the result is as if --ignore-quals is also set.

-c

The read sequences are given on command line. I.e. <m1>, <m2> and <singles> are comma-separated lists of reads rather than lists of read files. There is no way to specify read names or qualities, so -c also implies --ignore-quals.

-s/--skip <int>

Skip (i.e. do not align) the first <int> reads or pairs in the input.

-u/--qupto <int>

Align the first <int> reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop. Default: no limit.

-5/--trim5 <int>

Trim <int> bases from 5' (left) end of each read before alignment (default: 0).

-3/--trim3 <int>

Trim <int> bases from 3' (right) end of each read before alignment (default: 0).

--phred33

Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines.

--phred64

Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding.

--solexa-quals

Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3). Default: off.

--int-quals

Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified. Default: off.

Preset options in --end-to-end mode

--very-fast

Same as: -D 5 -R 1 -N 0 -L 22 -i S,0,2.50

--fast

Same as: -D 10 -R 2 -N 0 -L 22 -i S,0,2.50

--sensitive

Same as: -D 15 -R 2 -L 22 -i S,1,1.15 (default in --end-to-end mode)

--very-sensitive

Same as: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50

Preset options in --local mode

--very-fast-local

Same as: -D 5 -R 1 -N 0 -L 25 -i S,1,2.00

--fast-local

Same as: -D 10 -R 2 -N 0 -L 22 -i S,1,1.75

--sensitive-local

Same as: -D 15 -R 2 -N 0 -L 20 -i S,1,0.75 (default in --local mode)

--very-sensitive-local

Same as: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50

Alignment options

-N <int>

Sets the number of mismatches to allowed in a seed alignment during multiseed alignment. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0.

-L <int>

Sets the length of the seed substrings to align during multiseed alignment. Smaller values make alignment slower but more senstive. Default: the --sensitive preset is used by default, which sets -L to 20 both in --end-to-end mode and in --local mode.

-i <func>

Sets a function governing the interval between seed substrings to use during multiseed alignment. For instance, if the read has 30 characers, and seed length is 10, and the seed interval is 6, the seeds extracted will be:

Read:      TAGCTACGCTCTACGCTATCATGCATAAAC
Seed 1 fw: TAGCTACGCT
Seed 1 rc: AGCGTAGCTA
Seed 2 fw:       CGCTCTACGC
Seed 2 rc:       GCGTAGAGCG
Seed 3 fw:             ACGCTATCAT
Seed 3 rc:             ATGATAGCGT
Seed 4 fw:                   TCATGCATAA
Seed 4 rc:                   TTATGCATGA

Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying -i S,1,2.5 sets the interval function f to f(x) = 1 + 2.5 * sqrt(x), where x is the read length. See also: setting function options. If the function returns a result less than 1, it is rounded up to 1. Default: the --sensitive preset is used by default, which sets -i to S,1,1.15 in --end-to-end mode to -i S,1,0.75 in --local mode.

--n-ceil <func>

Sets a function governing the maximum number of ambiguous characters (usually Ns and/or .s) allowed in a read as a function of read length. For instance, specifying -L,0,0.15 sets the N-ceiling function f to f(x) = 0 + 0.15 * x, where x is the read length. See also: setting function options. Reads exceeding this ceiling are filtered out. Default: L,0,0.15.

--dpad <int>

"Pads" dynamic programming problems by <int> columns on either side to allow gaps. Default: 15.

--gbar <int>

Disallow gaps within <int> positions of the beginning or end of the read. Default: 4.

--ignore-quals

When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value. I.e. input is treated as though all quality values are high. This is also the default behavior when the input doesn't specify quality values (e.g. in -f, -r, or -c modes).

--nofw/--norc

If --nofw is specified, bowtie2 will not attempt to align unpaired reads to the forward (Watson) reference strand. If --norc is specified, bowtie2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes bowtie2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled.

--end-to-end

In this mode, Bowtie 2 requires that the entire read align from one end to the other, without any trimming (or "soft clipping") of characters from either end. The match bonus --ma always equals 0 in this mode, so all alignment scores are less than or equal to 0, and the greatest possible alignment score is 0. This is mutually exclusive with --local. --end-to-end is the default mode.

--local

In this mode, Bowtie 2 does not require that the entire read align from one end to the other. Rather, some characters may be omitted ("soft clipped") from the ends in order to achieve the greatest possible alignment score. The match bonus --ma is used in this mode, and the best possible alignment score is equal to the match bonus (--ma) times the length of the read. Specifying --local and one of the presets (e.g. --local --very-fast) is equivalent to specifying the local version of the preset (--very-fast-local). This is mutually exclusive with --end-to-end. --end-to-end is the default mode.

Scoring options

--ma <int>

Sets the match bonus. In --local mode <int> is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in --end-to-end mode. Default: 2.

--mp MX,MN

Sets the maximum (MX) and minimum (MN) mismatch penalties, both integers. A number less than or equal to MX and greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX. Otherwise, the number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value. Default: MX = 6, MN = 2.

--np <int>

Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as N. Default: 1.

--rdg <int1>,<int2>

Sets the read gap open (<int1>) and extend (<int2>) penalties. A read gap of length N gets a penalty of <int1> + N * <int2>. Default: 5, 3.

--rfg <int1>,<int2>

Sets the reference gap open (<int1>) and extend (<int2>) penalties. A reference gap of length N gets a penalty of <int1> + N * <int2>. Default: 5, 3.

--score-min <func>

Sets a function governing the minimum alignment score needed for an alignment to be considered "valid" (i.e. good enough to report). This is a function of read length. For instance, specifying L,0,-0.6 sets the minimum-score function f to f(x) = 0 + -0.6 * x, where x is the read length. See also: setting function options. The default in --end-to-end mode is L,-0.6,-0.6 and the default in --local mode is G,20,8.

Reporting options

-k <int>

By default, bowtie2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it continues looking for alignments that are nearly as good or better. The best alignment found is reported (randomly selected from among best if tied). Information about the best alignments is used to estimate mapping quality and to set SAM optional fields, such as AS:i and XS:i.

When -k is specified, however, bowtie2 behaves differently. Instead, it searches for at most <int> distinct, valid alignments for each read. The search terminates when it can't find more distinct valid alignments, or when it finds <int>, whichever happens first. All alignments found are reported in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. For reads that have more than <int> distinct, valid alignments, bowtie2 does not gaurantee that the <int> alignments reported are the best possible in terms of alignment score. -k is mutually exclusive with -a.

Note: Bowtie 2 is not designed with large values for -k in mind, and when aligning reads to long, repetitive genomes large -k can be very, very slow.

-a

Like -k but with no upper limit on number of alignments to search for. -a is mutually exclusive with -k.

Note: Bowtie 2 is not designed with -a mode in mind, and when aligning reads to long, repetitive genomes this mode can be very, very slow.

Effort options

-D <int>

Up to <int> consecutive seed extension attempts can "fail" before Bowtie 2 moves on, using the alignments found so far. A seed extension "fails" if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default: 15.

-R <int>

<int> is the maximum number of times Bowtie 2 will "re-seed" reads with repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default: 2.

Paired-end options

-I/--minins <int>

The minimum fragment length for valid paired-end alignments. E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates.

The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient.

Default: 0 (essentially imposing no minimum)

-X/--maxins <int>

The maximum fragment length for valid paired-end alignments. E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates.

The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient.

Default: 500.

--fr/--rf/--ff

The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. E.g., if --fr is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (-I and -X) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. --rf likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. --ff requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented. Default: --fr (appropriate for Illumina's Paired-end Sequencing Assay).

--no-mixed

By default, when bowtie2 cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates. This option disables that behavior.

--no-discordant

By default, bowtie2 looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (--fr/--rf/--ff, -I, -X). This option disables that behavior.

--dovetail

If the mates "dovetail", that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates cannot dovetail in a concordant alignment.

--no-contain

If one mate alignment contains the other, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: a mate can contain the other in a concordant alignment.

--no-overlap

If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates can overlap in a concordant alignment.

Output options

-t/--time

Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. Default: off.

--un <path>
--un-gz <path>
--un-bz2 <path>

Write unpaired reads that fail to align to file at <path>. These reads correspond to the SAM records with the FLAGS 0x4 bit set and neither the 0x40 nor 0x80 bits set. If --un-gz is specified, output will be gzip compressed. If --un-bz2 is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.

--al <path>
--al-gz <path>
--al-bz2 <path>

Write unpaired reads that align at least once to file at <path>. These reads correspond to the SAM records with the FLAGS 0x4, 0x40, and 0x80 bits unset. If --al-gz is specified, output will be gzip compressed. If --al-bz2 is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.

--un-conc <path>
--un-conc-gz <path>
--un-conc-bz2 <path>

Write paired-end reads that fail to align concordantly to file(s) at <path>. These reads correspond to the SAM records with the FLAGS 0x4 bit set and either the 0x40 or 0x80 bit set (depending on whether it's mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in <path> to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.

--al-conc <path>
--al-conc-gz <path>
--al-conc-bz2 <path>

Write paired-end reads that align concordantly at least once to file(s) at <path>. These reads correspond to the SAM records with the FLAGS 0x4 bit unset and either the 0x40 or 0x80 bit set (depending on whether it's mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in <path> to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.

--quiet

Print nothing besides alignments and serious errors.

--met-file <path>

Write bowtie2 metrics to file <path>. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: --met. Default: metrics disabled.

--met-stderr <path>

Write bowtie2 metrics to the "standard error" ("stderr") filehandle. This is not mutually exclusive with --met-file. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: --met. Default: metrics disabled.

--met <int>

Write a new bowtie2 metrics record every <int> seconds. Only matters if either --met-stderr or --met-file are specified. Default: 1.

SAM options

--no-unal

Suppress SAM records for reads that failed to align.

--no-hd

Suppress SAM header lines (starting with @).

--no-sq

Suppress @SQ SAM header lines.

--rg-id <text>

Set the read group ID to <text>. This causes the SAM @RG header line to be printed, with <text> as the value associated with the ID: tag. It also causes the RG:Z: extra field to be attached to each SAM output record, with value set to <text>.

--rg <text>

Add <text> (usually of the form TAG:VAL, e.g. SM:Pool1) as a field on the @RG header line. Note: in order for the @RG line to appear, --rg-id must also be specified. This is because the ID tag is required by the SAM Spec. Specify --rg multiple times to set multiple fields. See the SAM Spec for details about what fields are legal.

--omit-sec-seq

When printing secondary alignments, Bowtie 2 by default will write out the SEQ and QUAL strings. Specifying this option causes Bowtie 2 to print an asterix in those fields instead.

Performance options

-o/--offrate <int>

Override the offrate of the index with <int>. If <int> is greater than the offrate used to build the index, then some row markings are discarded when the index is read into memory. This reduces the memory footprint of the aligner but requires more time to calculate text offsets. <int> must be greater than the value used to build the index.

-p/--threads NTHREADS

Launch NTHREADS parallel search threads (default: 1). Threads will run on separate processors/cores and synchronize when parsing reads and outputting alignments. Searching for alignments is highly parallel, and speedup is close to linear. Increasing -p increases Bowtie 2's memory footprint. E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint by a few hundred megabytes. This option is only available if bowtie is linked with the pthreads library (i.e. if BOWTIE_PTHREADS=0 is not specified at build time).

--reorder

Guarantees that output SAM records are printed in an order corresponding to the order of the reads in the original input file, even when -p is set greater than 1. Specifying --reorder and setting -p greater than 1 causes Bowtie 2 to run somewhat slower and use somewhat more memory then if --reorder were not specified. Has no effect if -p is set to 1, since output order will naturally correspond to input order in that case.

--mm

Use memory-mapped I/O to load the index, rather than typical file I/O. Memory-mapping allows many concurrent bowtie processes on the same computer to share the same memory image of the index (i.e. you pay the memory overhead just once). This facilitates memory-efficient parallelization of bowtie in situations where using -p is not possible or not preferable.

Other options

--qc-filter

Filter out reads for which the QSEQ filter field is non-zero. Only has an effect when read format is --qseq. Default: off.

--seed <int>

Use <int> as the seed for pseudo-random number generator. Default: 0.

--non-deterministic

Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It seeds the generator with a number derived from (a) the read name, (b) the nucleotide sequence, (c) the quality sequence, (d) the value of the --seed option. This means that if two reads are identical (same name, same nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s) for both, even if there was ambiguity. When --non-deterministic is specified, Bowtie 2 re-initializes its pseudo-random generator for each read using the current time. This means that Bowtie 2 will not necessarily report the same alignment for two identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.

--version

Print version information and quit.

-h/--help

Print usage information and quit.

SAM output

Following is a brief description of the SAM format as output by bowtie2. For more details, see the SAM format specification.

By default, bowtie2 prints a SAM header with @HD, @SQ and @PG lines. When one or more --rg arguments are specified, bowtie2 will also print an @RG line that includes all user-specified --rg tokens separated by tabs.

Each subsequnt line describes an alignment or, if the read failed to align, a read. Each line is a collection of at least 12 fields separated by tabs; from left to right, the fields are:

  1. Name of read that aligned.

    Note that the SAM specification disallows whitespace in the read name. If the read name contains any whitespace characters, Bowtie 2 will truncate the name at the first whitespace character. This is similar to the behavior of other tools.

  2. Sum of all applicable flags. Flags relevant to Bowtie are:

    1

    The read is one of a pair

    2

    The alignment is one end of a proper paired-end alignment

    4

    The read has no reported alignments

    8

    The read is one of a pair and has no reported alignments

    16

    The alignment is to the reverse reference strand

    32

    The other mate in the paired-end alignment is aligned to the reverse reference strand

    64

    The read is mate 1 in a pair

    128

    The read is mate 2 in a pair

    Thus, an unpaired read that aligns to the reverse reference strand will have flag 16. A paired-end read that aligns and is the first mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).

  3. Name of reference sequence where alignment occurs

  4. 1-based offset into the forward reference strand where leftmost character of the alignment occurs

  5. Mapping quality

  6. CIGAR string representation of alignment

  7. Name of reference sequence where mate's alignment occurs. Set to = if the mate's reference sequence is the same as this alignment's, or * if there is no mate.

  8. 1-based offset into the forward reference strand where leftmost character of the mate's alignment occurs. Offset is 0 if there is no mate.

  9. Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome.

  10. Read sequence (reverse-complemented if aligned to the reverse strand)

  11. ASCII-encoded read qualities (reverse-complemented if the read aligned to the reverse strand). The encoded quality values are on the Phred quality scale and the encoding is ASCII-offset by 33 (ASCII char !), similarly to a FASTQ file.

  12. Optional fields. Fields are tab-separated. bowtie2 outputs zero or more of these optional fields for each alignment, depending on the type of the alignment:

    AS:i:<N>

    Alignment score. Can be negative. Can be greater than 0 in --local mode (but not in --end-to-end mode). Only present if SAM record is for an aligned read.

    XS:i:<N>

    Alignment score for second-best alignment. Can be negative. Can be greater than 0 in --local mode (but not in --end-to-end mode). Only present if the SAM record is for an aligned read and more than one alignment was found for the read.

    YS:i:<N>

    Alignment score for opposite mate in the paired-end alignment. Only present if the SAM record is for a read that aligned as part of a paired-end alignment.

    XN:i:<N>

    The number of ambiguous bases in the reference covering this alignment. Only present if SAM record is for an aligned read.

    XM:i:<N>

    The number of mismatches in the alignment. Only present if SAM record is for an aligned read.

    XO:i:<N>

    The number of gap opens, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.

    XG:i:<N>

    The number of gap extensions, for both read and reference gaps, in the alignment. Only present if SAM record is for an aligned read.

    NM:i:<N>

    The edit distance; that is, the minimal number of one-nucleotide edits (substitutions, insertions and deletions) needed to transform the read string into the reference string. Only present if SAM record is for an aligned read.

    YF:Z:<S>

    String indicating reason why the read was filtered out. See also: Filtering. Only appears for reads that were filtered out.

    YT:Z:<S>

    Value of UU indicates the read was not part of a pair. Value of CP indicates the read was part of a pair and the pair aligned concordantly. Value of DP indicates the read was part of a pair and the pair aligned discordantly. Value of UP indicates the read was part of a pair but the pair failed to aligned either concordantly or discordantly.

    MD:Z:<S>

    A string representation of the mismatched reference bases in the alignment. See SAM format specification for details. Only present if SAM record is for an aligned read.

The bowtie2-build indexer

bowtie2-build builds a Bowtie index from a set of DNA sequences. bowtie2-build outputs a set of 6 files with suffixes .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2, and .rev.2.bt2. These files together constitute the index: they are all that is needed to align reads to that reference. The original sequence FASTA files are no longer used by Bowtie 2 once the index is built.

Bowtie 2's .bt2 index format is different from Bowtie 1's .ebwt format, and they are not compatible with each other.

Use of Karkkainen's blockwise algorithm allows bowtie2-build to trade off between running time and memory usage. bowtie2-build has three options governing how it makes this trade: -p/--packed, --bmax/--bmaxdivn, and --dcv. By default, bowtie2-build will automatically search for the settings that yield the best running time without exhausting memory. This behavior can be disabled using the -a/--noauto option.

The indexer provides options pertaining to the "shape" of the index, e.g. --offrate governs the fraction of Burrows-Wheeler rows that are "marked" (i.e., the density of the suffix-array sample; see the original FM Index paper for details). All of these options are potentially profitable trade-offs depending on the application. They have been set to defaults that are reasonable for most cases according to our experiments. See Performance tuning for details.

Because bowtie2-build uses 32-bit pointers internally, it can handle up to a theoretical maximum of 2^32-1 (somewhat more than 4 billion) characters in an index, though, with other constraints, the actual ceiling is somewhat less than that. If your reference exceeds 2^32-1 characters, bowtie2-build will print an error message and abort. To resolve this, divide your reference sequences into smaller batches and/or chunks and build a separate index for each.

If your computer has more than 3-4 GB of memory and you would like to exploit that fact to make index building faster, use a 64-bit version of the bowtie2-build binary. The 32-bit version of the binary is restricted to using less than 4 GB of memory. If a 64-bit pre-built binary does not yet exist for your platform on the sourceforge download site, you will need to build one from source.

The Bowtie 2 index is based on the FM Index of Ferragina and Manzini, which in turn is based on the Burrows-Wheeler transform. The algorithm used to build the index is based on the blockwise algorithm of Karkkainen.

Command Line

Usage:

bowtie2-build [options]* <reference_in> <bt2_base>

Main arguments

<reference_in>

A comma-separated list of FASTA files containing the reference sequences to be aligned to, or, if -c is specified, the sequences themselves. E.g., <reference_in> might be chr1.fa,chr2.fa,chrX.fa,chrY.fa, or, if -c is specified, this might be GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA.

<bt2_base>

The basename of the index files to write. By default, bowtie2-build writes files named NAME.1.bt2, NAME.2.bt2, NAME.3.bt2, NAME.4.bt2, NAME.rev.1.bt2, and NAME.rev.2.bt2, where NAME is <bt2_base>.

Options

-f

The reference input files (specified as <reference_in>) are FASTA files (usually having extension .fa, .mfa, .fna or similar).

-c

The reference sequences are given on the command line. I.e. <reference_in> is a comma-separated list of sequences rather than a list of FASTA files.

-a/--noauto

Disable the default behavior whereby bowtie2-build automatically selects values for the --bmax, --dcv and --packed parameters according to available memory. Instead, user may specify values for those parameters. If memory is exhausted during indexing, an error message will be printed; it is up to the user to try new parameters.

-p/--packed

Use a packed (2-bits-per-nucleotide) representation for DNA strings. This saves memory but makes indexing 2-3 times slower. Default: off. This is configured automatically by default; use -a/--noauto to configure manually.

--bmax <int>

The maximum number of suffixes allowed in a block. Allowing more suffixes per block makes indexing faster, but increases peak memory usage. Setting this option overrides any previous setting for --bmax, or --bmaxdivn. Default (in terms of the --bmaxdivn parameter) is --bmaxdivn 4. This is configured automatically by default; use -a/--noauto to configure manually.

--bmaxdivn <int>

The maximum number of suffixes allowed in a block, expressed as a fraction of the length of the reference. Setting this option overrides any previous setting for --bmax, or --bmaxdivn. Default: --bmaxdivn 4. This is configured automatically by default; use -a/--noauto to configure manually.

--dcv <int>

Use <int> as the period for the difference-cover sample. A larger period yields less memory overhead, but may make suffix sorting slower, especially if repeats are present. Must be a power of 2 no greater than 4096. Default: 1024. This is configured automatically by default; use -a/--noauto to configure manually.

--nodc

Disable use of the difference-cover sample. Suffix sorting becomes quadratic-time in the worst case (where the worst case is an extremely repetitive reference). Default: off.

-r/--noref

Do not build the NAME.3.bt2 and NAME.4.bt2 portions of the index, which contain a bitpacked version of the reference sequences and are used for paired-end alignment.

-3/--justref

Build only the NAME.3.bt2 and NAME.4.bt2 portions of the index, which contain a bitpacked version of the reference sequences and are used for paired-end alignment.

-o/--offrate <int>

To map alignments back to positions on the reference sequences, it's necessary to annotate ("mark") some or all of the Burrows-Wheeler rows with their corresponding location on the genome. -o/--offrate governs how many rows get marked: the indexer will mark every 2^<int> rows. Marking more rows makes reference-position lookups faster, but requires more memory to hold the annotations at runtime. The default is 5 (every 32nd row is marked; for human genome, annotations occupy about 340 megabytes).

-t/--ftabchars <int>

The ftab is the lookup table used to calculate an initial Burrows-Wheeler range with respect to the first <int> characters of the query. A larger <int> yields a larger lookup table but faster query times. The ftab has size 4^(<int>+1) bytes. The default setting is 10 (ftab is 4MB).

--seed <int>

Use <int> as the seed for pseudo-random number generator.

--cutoff <int>

Index only the first <int> bases of the reference sequences (cumulative across sequences) and ignore the rest.

-q/--quiet

bowtie2-build is verbose by default. With this option bowtie2-build will print only error messages.

-h/--help

Print usage information and quit.

--version

Print version information and quit.

The bowtie2-inspect index inspector

bowtie2-inspect extracts information from a Bowtie index about what kind of index it is and what reference sequences were used to build it. When run without any options, the tool will output a FASTA file containing the sequences of the original references (with all non-A/C/G/T characters converted to Ns). It can also be used to extract just the reference sequence names using the -n/--names option or a more verbose summary using the -s/--summary option.

Command Line

Usage:

bowtie2-inspect [options]* <bt2_base>

Main arguments

<bt2_base>

The basename of the index to be inspected. The basename is name of any of the index files but with the .X.bt2 or .rev.X.bt2 suffix omitted. bowtie2-inspect first looks in the current directory for the index files, then in the directory specified in the BOWTIE2_INDEXES environment variable.

Options

-a/--across <int>

When printing FASTA output, output a newline character every <int> bases (default: 60).

-n/--names

Print reference sequence names, one per line, and quit.

-s/--summary

Print a summary that includes information about index settings, as well as the names and lengths of the input sequences. The summary has this format:

Colorspace  <0 or 1>
SA-Sample   1 in <sample>
FTab-Chars  <chars>
Sequence-1  <name>  <len>
Sequence-2  <name>  <len>
...
Sequence-N  <name>  <len>

Fields are separated by tabs. Colorspace is always set to 0 for Bowtie 2.

-v/--verbose

Print verbose output (for debugging).

--version

Print version information and quit.

-h/--help

Print usage information and quit.

Getting started with Bowtie 2: Lambda phage example

Bowtie 2 comes with some example files to get you started. The example files are not scientifically significant; we use the Lambda phage reference genome simply because it's short, and the reads were generated by a computer program, not a sequencer. However, these files will let you start running Bowtie 2 and downstream tools right away.

First follow the manual instructions to obtain Bowtie 2. Set the BT2_HOME environment variable to point to the new Bowtie 2 directory containing the bowtie2, bowtie2-build and bowtie2-inspect binaries. This is important, as the BT2_HOME variable is used in the commands below to refer to that directory.

Indexing a reference genome

To create an index for the Lambda phage reference genome included with Bowtie 2, create a new temporary directory (it doesn't matter where), change into that directory, and run:

$BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virus

The command should print many lines of output then quit. When the command completes, the current directory will contain four new files that all start with lambda_virus and end with .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2, and .rev.2.bt2. These files constitute the index - you're done!

You can use bowtie2-build to create an index for a set of FASTA files obtained from any source, including sites such as UCSC, NCBI, and Ensembl. When indexing multiple FASTA files, specify all the files using commas to separate file names. For more details on how to create an index with bowtie2-build, see the manual section on index building. You may also want to bypass this process by obtaining a pre-built index. See using a pre-built index below for an example.

Aligning example reads

Stay in the directory created in the previous step, which now contains the lambda_virus index files. Next, run:

$BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.sam

This runs the Bowtie 2 aligner, which aligns a set of unpaired reads to the Lambda phage reference genome using the index generated in the previous step. The alignment results in SAM format are written to the file eg1.sam, and a short alignment summary is written to the console. (Actually, the summary is written to the "standard error" or "stderr" filehandle, which is typically printed to the console.)

To see the first few lines of the SAM output, run:

head eg1.sam

You will see something like this:

@HD VN:1.0  SO:unsorted
@SQ SN:gi|9626243|ref|NC_001416.1|  LN:48502
@PG ID:bowtie2  PN:bowtie2  VN:2.0.1
r1  0   gi|9626243|ref|NC_001416.1| 18401   42  122M    *   0   0   TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG  +"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C>  AS:i:-5 XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:59G13G21G26    YT:Z:UU
r2  0   gi|9626243|ref|NC_001416.1| 8886    42  275M    *   0   0   NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC (#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-14    XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU
r3  16  gi|9626243|ref|NC_001416.1| 11599   42  338M    *   0   0   GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT  7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?&#0.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6  AS:i:-22    XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:80C4C16A52T23G30A8T76A41   YT:Z:UU
r4  0   gi|9626243|ref|NC_001416.1| 40075   42  184M    *   0   0   GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGT(=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G AS:i:-1 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:77C106 YT:Z:UU
r5  0   gi|9626243|ref|NC_001416.1| 48010   42  138M    *   0   0   GTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTT  9''%<D)A03E1-*7=),:F/0!6,D9:H,<9D%:0B(%'E,(8EFG$E89B$27G8F*2+4,-!,0D5()&=(FGG:5;3*@/.0F-G#5#3->('FDFEG?)5.!)"AGADB3?6(@H(:B<>6!>;>6>G,."?%  AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:138    YT:Z:UU
r6  16  gi|9626243|ref|NC_001416.1| 41607   42  72M2D119M   *   0   0   TCGATTTGCAAATACCGGAACATCTCGGTAACTGCATATTCTGCATTAAAAAATCAACGCAAAAAATCGGACGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATNCCATGTGCGTGACGGNCATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT 1H#G;H"$E*E#&"*)2%66?=9/9'=;4)4/>@%+5#@#$4A*!<D=="8#1*A9BA=:(1+#C&.#(3#H=9E)AC*5,AC#E'536*2?)H14?>9'B=7(3H/B:+A:8%1-+#(E%&$$&14"76D?>7(&20H5%*&CF8!G5B+A4F$7(:"'?0$?G+$)B-?2<0<F=D!38BH,%=8&5@+ AS:i:-13    XN:i:0  XM:i:2  XO:i:1  XG:i:2  NM:i:4  MD:Z:72^TT55C15A47  YT:Z:UU
r7  16  gi|9626243|ref|NC_001416.1| 4692    42  143M    *   0   0   TCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACAGCATTCTGCTCGATATGGACANGCCCGGCGGGATGGTGGCGGGG -"/@*7A0)>2,AAH@&"%B)*5*23B/,)90.B@%=FE,E063C9?,:26$-0:,.,1849'4.;F>FA;76+5&$<C":$!A*,<B,<)@<'85D%C*:)30@85;?.B$05=@95DCDH<53!8G:F:B7/A.E':434> AS:i:-6 XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:2  MD:Z:98G21C22   YT:Z:UU

The first few lines (beginning with @) are SAM header lines, and the rest of the lines are SAM alignments, one line per read or mate. See the Bowtie 2 manual section on SAM output and the SAM specification for details about how to interpret the SAM file format.

Paired-end example

To align paired-end reads included with Bowtie 2, stay in the same directory and run:

$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam

This aligns a set of paired-end reads to the reference genome, with results written to the file eg2.sam.

Local alignment example

To use local alignment to align some longer reads included with Bowtie 2, stay in the same directory and run:

$BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.sam

This aligns the long reads to the reference genome using local alignment, with results written to the file eg3.sam.

Using SAMtools/BCFtools downstream

SAMtools is a collection of tools for manipulating and analyzing SAM and BAM alignment files. BCFtools is a collection of tools for calling variants and manipulating VCF and BCF files, and it is typically distributed with SAMtools. Using these tools together allows you to get from alignments in SAM format to variant calls in VCF format. This example assumes that samtools and bcftools are installed and that the directories containing these binaries are in your PATH environment variable.

Run the paired-end example:

$BT2_HOME/bowtie2 -x $BT2_HOME/example/index/lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam

Use samtools view to convert the SAM file into a BAM file. BAM is a the binary format corresponding to the SAM text format. Run:

samtools view -bS eg2.sam > eg2.bam

Use samtools sort to convert the BAM file to a sorted BAM file.

samtools sort eg2.bam eg2.sorted

We now have a sorted BAM file called eg2.sorted.bam. Sorted BAM is a useful format because the alignments are (a) compressed, which is convenient for long-term storage, and (b) sorted, which is conveneint for variant discovery. To generate variant calls in VCF format, run:

samtools mpileup -uf $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -bvcg - > eg2.raw.bcf

Then to view the variants, run:

bcftools view eg2.raw.bcf

See the official SAMtools guide to Calling SNPs/INDELs with SAMtools/BCFtools for more details and variations on this process.